Bioteknologi Tanaman Cabe Resisten CMV

BAB I. PENDAHULUAN

1.1. Latar Belakang

Tanaman cabe memiliki tingkat permintaan yang cukup tinggi di tingkat konsumen. Berdasarkan data BPS tahun 1999, laju permintaan terhadap tanaman ini terus mengalami peningkatan 13 % setiap tahun. Tingginya laju permintaan ini tidak berbanding lurus dengan produktifitas pengembangan tanaman cabe di Indonesia. Posisi Indonesia masih posisi terendah di Asia tenggara disebabkan produktifitas cabenya hanya menghasilkan 2,6 ton/tahun dibandingkan rata-rata produktifitas Asia tenggara yang berkisar 8- 9 ton./tahun.

Rendahnya suatu produktifitas cabe tidak bisa disebabkan keterbatasan lahan. Namun hal yang lebih penting adalah kemampuan petani dalam meningkatkan produktifitas pada lahan yang terbatas. Kemampuan menyeleksi benih, teknik budidaya yang bagus serta kemampuan dalam pemberantasan hama dan penyakit menjadi kunci dalam meningkatkan laju produktifitas cabe di pasaran. Penggunaan cabe dengan tahan terhadap hama dan penyakit serta produksi panen yang tinggi menjadi solusi terbaik.

Keberadaan tanaman transgenik sudah semakin tak asing lagi di tengah masyarakat yang hidup dengan ilmu pengetahuan dan teknologi yang tinggi masa sekarang. Berbagai tanaman transgenik sudah diciptakan untuk berbagai tanaman budidaya, salah satunya adalah terhadap tanaman cabe (Capsicum annuum) transgenik

Cabe transgenik adalah salah satu jenis tanaman yang sudah mengalami rekayasa genetika dari sisi bentuk dan kualitasnya melalui penyisipan gen atau DNA hewan, tumbuhan, bakteri, virus dan mikroba lainnya dengan tujuan tertentu.  Penyisipan gen ke dalam tanaman ini disebabkan gen yang disisipkan mempunyai keunggulan tertentu sehingga mampu meningkatkan pemuliaan tanaman yang disisipkan. Keunggulan yang didapatkan diantaranya adalah tanaman memiliki ketahanan terhadap hama, tahan cuaca, umur lebih pendek untuk panen, kualitas yang bagus dan kandungan nutrisinya yang lebih tinggi. Dengan demikian kebutuhan pangan akan cepat tersedia dengan penghematan biaya yang lebih rendah dari tanaman yang bukan transgenik. (Ayu, 2009).

Kemajuan tanaman cabe transgenik tidak terlepas dari kemajuan IPTEK yang dimiliki suatu bangsa. Dari sisi kemajuan bioteknologi tanaman secara umum, Indonesia masih berada pada gelombang I dan sedang menuju ke gelombang II, dibandingkan dengan negara-negara maju seperti Amerika Serikat, Canada, Argentina, China dan negara-negara eropa yang sudah berada pada gelombang III. Gelombang I secara umum menunjukan bahwa hasil produk transgenik masih terfokus pada penciptaan ketahanan tanaman terhadap cekaman biotik dan abiotik. Berbeda dengan gelombang II yang sudah mencakup kepada kajian secara medis. Sedangkan gelombang III sendiri sudah memfokuskan pada peningkatan kandungan nutrisi pada suatu tanaman.

Indonesia masih sangat kurang dalam melakukan penelitian, pengembangan dan bahkan menghasilkan produk cabe transgenik. Berdasarkan data dari Amir Husin (2004, cit Subagiono (2002)) terkait hasil penelitian dari lembaga-lembaga penelitian dibawah Badan Penelitian Pengembangan Pertanian dan Pusat Penelitian Pengembangan Bioteknologi LIPI serta Pusat Penelitian Antar Universitas di IPB Bogor, ternyata penelitian cabe secara rekayasa genetik belum dilakukan. Tanaman yang baru sudah dihasilkan adalah jagung tahan hama wereng, Kacang tanah tahan peanut stripe virus, kakao tahan penggerek buah Bt, dan kedelai tahan penggerek polong. Padi tahan penggerek batang dan wereng coklat, pepaya tahan papaya ring spot virus, dan tebu tahan penggerek batang. Tembakau tahan tobacco mozaik virus dan ubi jalar tahan hama boleng.

Penelitian cabai transgenik baru diketahui berdasarkan laporan Mulya et al (2005) bahwa laboratorium Virologi IPB telah mengadakan serangkaian penelitian untuk mendapatkan tanaman cabai yang tahan virus melalui pemulian tanaman dan rekayasa genetika. Untuk diketahui, virus-virus yang sering menginfeksi tanaman cabai adalah  virus mozaik ketimun (CMV), virus etch tembakau (TEV), virus mozaik tembakau (TMV), virus Y kentang (PVY), dan Chili veinal mottle virus (CVMV). CMV tanaman cabai (Capsicum annuum) dengan tanda-tanda terjadinya bercak-bercak (mozaik) pada daun. Akibatnya buah cabai gagal diproduksi sehingga terjadi reduksi hasil panen.

Penulisan makalah ini mencoba menelaah dan membandingkan tingkat perkembangan penelitian cabai transgenik Indonesia dan beberapa negara maju di dunia sehingga diharapkan mampu meningkatkan motivasi bangsa ini untuk mengejar ketertinggalan dari sisi IPTEK dengan bangsa lain..

1.2. Rumusan Masalah

Beranjak dari latar belakang diatas maka penulisan makalah ini akan membahas permasalahan berikut ini :

  1. Sejauh manakah tingkat perkembangan penelitian cabai transgenik di Indonesia ?
  2. Sejauh manakah perkembangan transgenik yang telah dilakukan negara-negara maju di dunia ?

1.3. Tujuan

  1. Mengetahui tingkat perkembangan penelitian cabai transgenik Indonesia
  2. Mengetahui tingkat perkembangan penelitian cabai transgenik negara-negara maju di dunia

BAB II. PERKEMBANGAN PENELITIAN

CABAI TRANSGENIK INDONESIA

2.1. Cikal Bakal Dimulainya Penelitian Cabai Transgenik

Penelitian cabai transgenik di Indonesia masih sangat jarang dilakukan oleh lembaga-lembaga peneliti ataupun instansi pendidikan. Hingga tahun 2004, laporan Amir Husin (2004, cit Subagiono (2002)) menyatakan bahwa lembaga-lembaga penelitian nasional seperti Badan Penelitian Pengembangan Pertanian dan Pusat Penelitian Pengembangan Bioteknologi LIPI serta Pusat Penelitian Antar Universitas di IPB Bogor belum menghasilkan produk penelitian cabai transgenik.  Penelitian ini baru diketahui setelah laporan penelitian Mulya (2005) menyatakan laboratorium virologi Institut Pertanian Bogor (IPB) telah melakukan serangkaian penelitian untuk mendapatkan tanaman cabai yang tahan virus dengan pendekatan pemulian tanaman dan rekayasa genetika.  Selain cabai transgenik tahan virus, Yus (2008) juga sudah mulai melakukan penelitian cabai transgenik yang tahan terhadap cekaman biotik dan abiotik dengan gen P5CS

Menurut Mulya (2005), untuk mendapatkan tanaman cabai transgenik tahan virus ada tiga kunci yang harus dilakukan yaitu:

1).  Tersedianya gen antivirus (gen CP CMV)

2). Tersedianya cara introduksi gen CP ke dalam genom tanaman cabai dan regenerasi cabai transgeniknya

3). Ekspresi gen CP pada tanaman transforman

Jika salah satu dari tiga komponen tersebut tidak ada maka akan sangat sulit melakukan penelitian menghasilkan tanaman cabai transgenik. Komponen poin 1 dan 2 sudah tersedia berkat hasil penelitian oleh Siregar dan Sudarsono pada tahun 1997.

Mulya (2005) dalam penelitian lainnya menyatakan bahwa tanaman cabai transgenik yang tahan virus PVY (CP PVY) telah diperoleh dan diuji ketahanannya. Begitupula dengan sejumlah varietas dan galur tanaman cabai yang mempunyai ketahanan alamiah (natural resistant) dengan berbagai karakter agronomis juga sudah diuji dan diperoleh untuk dikoleksi. Adapun virus CMV merupakan virus yang komplek menimbulkan dampak terhadap tanaman cabai.

2.2. Penelitian Edy Batara Mulya Siregar dengan judul “ Kontruksi Gen Cp CMV pada Agrobacterium” (2005).

Untuk menyediakan tanaman cabe transgenik yang tahan terhadap CMV, Edy Batara melakukan beberapa tahapan penelitian yang menjadi tujuan dasar dilaksanakan penelitian ini, yaitu: 1. menyedian gen anti virus CMV (CP CMV)

2. menghasilkan vektor transforman yang mengandung gen CP CMV

3. menghasilkan planlet tanaman cabe transgenik yang mengandung gen CP CMV

Dalam menyediakan gen anti virus CMV, Edy Batara terlebih dahulu melakukan tahapan-tahapan sebagai berikut secara ringkas :

a. Disain primer oligonukleotida gen CP CMV

Disain ini membutuhkan 20 pasang basa yang dirancang berdasarkan hasil publikasi ( Namba et al, 1991).

Tabel 1. Primer spesifik yang digunakan untuk mengamplifikasi CP CMV menurut Namba et al (1991).

Primer Urutan Nukleotida
Primer F 5’ AGCTAACCATGGACAAATCTGGATGTCCCAAT 3’
Primer R 5’ AGCAATCCATGGGGCAGTTTGAAGCAATACTACC 3’

b. Ekstraksi RNA total dari sampel tanaman

Pengambilan sampel CMV adalah dari sampel tanaman tembakau yang terinfeksi CMV. Diambil sebanyak 0,1 g digerus dalam 600 µl larutan (3 ml STE 2x, 0,03 g SDS dan 30 µl  mercaptoethanol  sampai hancur dan larut. Larutan SAP yang diperoleh disentrifugasi pada 12 000 rpm pada suhu 4’ C selama 5 menit. Supernatan diambil 200 µl dan ditambahkan 200 µl PCI, divorteks sampai homogen dan kemudian di sentrifugasi  12 000 rpm selama 5 menit (diulang selama 2 x). supernatan sebanyak 200 µl dan ditambahkan 200 µl chloroform, divorteks sampai homogen dan kemudian disentrifugasi pada 12 000 rpm selama 5 menit (diulang selama 2x). Supernatan yang diperoleh ditambah 0,1 volume supernatan dengan 3 M NaOc dan 3 x volume supernatan  dengan larutan ethanol 99 % dingin. Setelah dibolak-balik suspensi disimpan pada-20’C selama 2 jam. Selanjutnya disentrifugasi 12 000 rpm selama 5 menit pada suhu 4’C. Pelet yang diperoleh dicuci dengan 150 µl ethanol 70% dingin, kemudian disentrifugasi  12 000 rpm selama 5 menit pada suhu 4’C. Ethanol diambil secara perlahan-lahan dan divakum sampai kering selama 20 menit, kemudian ditambahkan 10µl aquabidest.Setelah divorteks sampai larut, suspensi RNA dipindahkan ke PCR tube dan siap digunakan untuk RT-PCR atau disimpan pada suhu -20’C.

c. Proses RT-PCR CP CMV

Proses reverse transcription polymerase chain reaction ) atau reaksi transkripsi balik yang dilakukan menurut Bohringer Mannheim RT-PCR kit.

d. Kloning dan konstruksi gen CP CMV pada plasmid vektor

Kloning bertujuan untuk memperoleh klon bakteri yang mengandung plasmid recombinan antara cDNA CP CMV dengan  plasmid vektor. Awal kloning  cDNA CP CMV dilakukan dengan meligasikannya pada plasmid vektor. Plasmid vektor yang digunakan adalah pGEM-T Easy berukuran 3018 bp (promega) yang mempunyai kelebihan nukleotida T (T-overhang) pada kedua ujung situs kloning.

e. Transformasi plasmid rekombinan

Transformasi plasmid recombinan dilakukan ke dalam Eschericia coli DH5a yang kompeten (Max eficiency). Prosedur transformasi adalah; 2 µl larutan hasil ligasi ditambahkan 50 µl sel E.coli yang kompeten dan diinkubasikan selama 20 menit dalam es, perlakuan panas (heat shock) selama 50 detik pada suhu 42’C dan segera dikembalikan ke dalam es selama 2 menit. Kemudian ditambahkan 950 µl media SOC dan diinkubasi selama 1,5 jam pada suhu 37 ‘ C sambil digoyang dengan kecepatan 200 rpm. Sebanyak 100 ml dari kultur cair bakteri tersebut dikulturkan pada media seleksi LB yang mengandung ampisilin dan X-gal, serta diinkubasikan selama 12 jam pada suhu 37 ‘C

f. seleksi klon positif

Klon positif (koloni bakteri berwarna putih) diseleksi menggunakan teknik (Thomson & Dietzgen, 1997).Satu koloni diambil dengan tusuk gigi steril dan diresuspensikan ke dalam 1 µl air steril. Reaksi campuran kosentrasi akhir mengandung 0,2 mM dNTP, 1.5 unit tag polymerase, 1 µl reverse dan forward primer, dan akuabidest ditambahkan sehingga volume akhir 24 µl. Reaksi PCR dilakukan pada mesin PCR Perkin Elmer 4800 dengan siklus 94’C selama 1 menit, 25 siklus 94’C selama 10 detik, 50 ‘C selama 20  detik, dan 72 ‘C selama 60 detik sebelum didinginkan sampai 15 ‘ C. Produk amplifikasi dideteksi dengan elektroforesis gel agarosa untuk melihat adanya insersi dalam ukuran DNA.

g. Konstruksi vektor transformasi

DNA CP CMVdiinsersikan ke dalam plasmid pCAMBIA 1301 yang mengandung promoter kuat 35 S untuk tanaman. Vektor biner akan dibuat dengan mengikuti metode yang dijelaskan oleh Hoekema et al (1983) dan Bevan (1984). Plasmid  pCAMBIA 1301 yang mengandung gen CP CMV yang dimobilisasikan A. tumefeciens strain EHA101 dan EHA 105 dengan system try parental mating dengan menggunakan bantuan bakteri penolong HB101(pRK2013). Selanjutnya bakteri diseleksi dengan menggunakan antibiotik penyeleksi.     

2.3. Penelitian Edy Batara Mulya Siregar dan Emmy Harso Kardinata dengan judul “ Rekayasa Genetika Tanaman Cabai (Capsicum annuum L) Tahan Virus Mozaik Ketimun (CMV)” (2005)

Ada tiga tujuan khusus penelitian yang dilakukan oleh Edy Batara Mulya Siregar dan Emmi Harso Kardinata ini, yaitu;

1) menyediakan gen antivirus CMV (CP CMV).

2) menghasilkan vektor transforman yang mengandung gen CP CMV

3) menghasilkan planlet tanaman cabai yang mengandung gen CP CMV

Selain itu juga ada tiga aktifitas penting yang dilakukan pada penelitian tersebut yaitu; introduksi gen CP CMV ke dalam genom tanaman cabai, analisis molekuler tanaman transgenik, uji ketahanan tanaman transgenik serta mengetahui pola pewarisan gen CP CMV yang terdapat pada tanaman transgenik.

Aktifitas introduksi gen CP CMV meliputi persiapan kultur bakteri, kokultivasi, seleksi dan pemeliharaan kultur. Tiga kultivar cabai yang disediakan adalah Tit.L Super, Jatilaba dan Laris digunakan sebagai tanaman bahan percobaan. Daun dari kecambah cabai in vitro yang berumur 21 hari digunakan sebagai eksplan untuk di kokultivasi dengan kultur Agrobacterium dengan cara merendam eksplan di dalam suspensi bakteri selama lima menit. Kemudian eksplan dikulturkan pada media regenerasi, yaitu media dasar MS yang ditambahkan BAP (4 mg/l) dan IAA (0,25 mg/l), antibiotik penyeleksi (50 dan 100 mg/l sesuai perlakukuan). Jumlah antibiotik yang ditambahkan pada media merupakan bagian percobaan untuk mengetahui efisiensi transformasi. Selain itu pada media juga ditambahkan antibiotik cefotaxime (500 mg/l) untuk membunuh Agrobacterium. Eksplan disubkultur pada media seleksi yang masih segar setiap tujuh hari sekali. Semua kultur diinkubasikan dalam ruang kultur dengan intensitas penyinaran  1000 sampai 1500 lux selama 24 jam. Suhu ruangan diatur berkisar 26-28 ‘C. Pengamatan pada aktifitas tersebut adalah pada jumlah eksplan yang hidup, eksplan yang beregenerasi dan jumlah tunas yang terbentuk.

Adapun untuk aktifitas analisis molekuler tanaman transgenik, uji ketahanan tanaman transgenik serta mengetahui pola pewarisan gen CP CMV tidak dipublikasikan oleh Edy Batara Mulya Siregar dan Emmi Harso Kardinata. Laporan akhir penelitian mereka menyebutkan masih menunggu tunas tanaman membesar dan lengkap sehingga baru bisa dilakukan analisis molekuler.

Hasil dari Aktifitas penelitian pada tahap introduksi gen CP CMV ke dalam genom tanaman cabai belum memperlihatkan hasil yang maksimal. Hasil pengamatan baru mengetahui  pengaruh  tingkat populasi bakteri pada jumlah OD600=0,2 dan OD600=0,5. Waktu inokulasi 2,5 dan 5 menit; waktu kokultivasi 0, 1 dan 2 hari; dan pengaruh prekultur (1, 2 dan 3 hari) sebelum eksplan di kokultivasi. Respon eksplan justru memperlihatkan daya hidup yang sangat rendah. Hanya saja, belum dipublikasikan produk planlet yang diharapkan.

BAB III. PERKEMBANGAN PENELITIAN

CABAI TRANSGENIK DI DUNIA

Penelitian terkait cabe transgenik sudah cukup banyak dilakukan para ahli bioteknologi tanaman di dunia. Beberapa penelitian yang dilakukan diantaranya adalah :

3.1. S. J. Kim , S. J. Lee , B.-D. Kim dan K.-H. Paek dengan judul penelitian “ Satellite-RNA-mediated resistance to cucumber mosaic virus in transgenic plants of hot pepper (Capsicum annuum cv. Golden Tower)” (Plant cell report/1997)

S. J. Kim · S. J. Lee · B.-D. Kim (Department of Horticulture, Seoul National University, K.-H. Paek (Graduate School of Biotechnology, Korea University, Seoul ). Present address: Department of Vegetable Crop, University of California, Davis,  USA

Tahapan-tahapan metoda penelitiannya adalah:

1. Penyediaan bahan tanaman dan virus

Tipe strain dari CMV –Y dan CMV- Kor disiapkan yang diperoleh dari Dr Eun Kyung Park dan Lembaga Penelitian Tembakau. Virus CMV dipertahankan sebagai partikel untuk dimurnikan pada -70 ° C. Tanaman  Capsicum annuum T1 disiapkan yang diperoleh dari hasil polinasi tanaman T0 yang digunakan dalam penelitian ini. Chenopodium amaranticolor adalah digunakan sebagai host lokal untuk dua strain CMV.

2.Seleksi dengan menggunakan kanamycin

Dua tanaman transgenik To bebas yang memproduksi RNA satelit CMV , kemudian dibuahi sendiri untuk menghasilkan biji tanaman T1. Setelah itu dilakukan analisis segregasi progeni dengan kosentrasi kanamycin yang berbeda-beda terhadap kecambah biji T1 dalam medium MS. Penambahan kosentrasi kanamysin adalah 50, 100, 150, 200 dan 250 mg/l kanamycin sulfate.   Dipilih kosentrasi 200 mg/l untuk segregasi analisis progeni dan diambil anakan yang tahan terhadap seleksi kanamycin yang didapatkan setelah  6 minggu setelah germinasi (setelah terbentuknya sel-sel kelamin).

3. Lakukan Polymerase chain reaction (PCR)

Dua derivat oligonukleotida spesifik yang berasal dari gen neomycin phospo transferase II (npt II) digunakan sebagai bahan primer untuk analysis PCR. Satu nukleotida (5′-GAGGCTATTCGGCTATGACTG-3′) berlokasi pada posisi 201–221 dari gen npt II  dan lainnya (5′-ATCGGGAGCGGCGATACCGTA-3′) pada posisi 900–880 (Beck et al. 1982). Genom DNA dipersiapkan dan diamplifikasi oleh prosedur modifikasi oleh Edwards et al. (1991). Reaksi PCR dilakukan dalam 50 µl larutan yang mengandung 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 50 µg/ml BSA, 0.001% gelatin, 200 µM masing-masing dari dNTPs, 2 unit dari Taq DNA polymerase and 50 pmol setiap oligonucleotida primer. Reaksi PCR dilakukan pada thermal cycler (Perkin Elmer Cetus) dengan diawali dengan denaturasi selama 2 menit pada suhu 94°C dan kemudian 30 siklus selama 1 menit pada suhu 94 ° C, 1 menit pada 55 ° C, dan 2 menit pada suhu 72 ° C, diikuti dengan langkah akhir 7 menit pada 72 ° C. PCR products disimpan pada 4 ° C sebelum gel analisis.

4. Analisis blot gel RNA

Seluruh RNA diektraksi dari daun  tanaman T0 dan T1 pada determinasi ekspresi cDNA klon dari RNA Satelit CMV (Chomczynski and Sacchi 1987). Sampel RNA sebanyak 10 mg diujikan dengan folmaldehid dan formamide menurut Sambrook et al.
(1989). Sampel dielektroforesis pada 1,0 % gel agarosa yang mengandung 0,67 M formaldehid. Kemudian ditransfer pada suatu membran nylon. Membran itu dihibridisasi pada suhu 42 ° C selama 18 jam dalam 0,1 % SDS, 5 x solusi Denhardt’s, 5 × SSPE, dan dipotong sebanyak 100 mg / ml, didenaturasi dengan sperma DNA ikan haring yang mengandung 50 % formamide. Pemeriksaan terhadap DNA dilakukan oleh label sebuah fragmen SCAI 0.3-kb (Paek dan Hahn 1991) dengan [α-32P]dCTP menggunakan methoda priming random (Feinberg and Vogelstein 1983). Membran tersebut dicuci dengan agitasi konstan, dua kali pada 2 × SSPE ditambah 0.1% SDS selama 15 menit pada suhu 42°C, dan sekali pada 0.1× SSPE ditambah 0.1% SDS selama 10 menit pada suhu  52°C. Membran diekspos pada sinar X dengan satu layar intensif suhu –70°C.

5. Mekanisasi test inokulasi

Tanaman T1 diambil daunnya sebanyak tujuh hingga delapan untuk digunakan dalam test inokulasi virus. CMV-Y dan CMV-Kor- yang sebelumnya didemonstrasikan tidak memiliki satelit RNA (Kim et al. 1995) digunakan pada inokulasi tanaman non transformasi dan transgenik. Dua atau tiga daun dari tanaman nontransformasi dan transgenik mengekspresikan RNA satelit. Kemudian ditaburi carborundum (500 mesh)

Dan mekanisasi inokulasi dengan CMV-Y or CMV-Kor pada kosentrasi 10 µg/ml dalam 0.01 M sodium phosphate buffer, pH 7.2. Setelah diinokulasi, permukaan daun dibilas dengan air keran, ditumbuhkan pada rumah kaca pada suhu 22-30 ° C. Gejala perkembangan dimonitor setiap hari selama kurang lebih 2 bulan setelah diinokulasi. CMV-Kor menghasilkan khas mosaik dan daun-keriting, sementara  CMV-Y biasanya menghasilkan mosaik kuning parah dan klorosis pada cabe. Untuk melihat kuantifikasi dan konfirmasi gejala attenuasi (kekurangan), dilakukan test lokal pada tanaman Capsicum amaranticolor

3.2. Gyulai G, J.A. Gemesne, Zs. Sagi, L. Zatyko, L. Heszky, G. Venczel dengan judul penelitian PCR-ANALYSIS OF F1 HYBRID DERIVED DH PEPPER LINES ” (1999). *Department of Genetics and Plant Breeding, Agricultural University, Godollo, H-2103. **Vegetable Crops Research Institute, Budapest, Hungary.

Metoda Penelitiannya adalah

Kultur antera. F1 hibrida dari hasil persilangan intercultivar sebagai tanaman antera donor ditanam di rumah kaca. Tunas bunga dikumpulkan pada tahap mikrospora uni nukleat. Kumpulan kepala sari ( 15 anthera per petridish, 6 cm) dipotong dan diletakkan pada suatu media nutrisi Dumas Vaulx de et (1981), ditambah dengan 0,01 mg/l 2 ,4 dichlorophenoxyacetic acid (2,4-D) dan kinetin masing-masingnya. Sumber gula dan kosentrasi dirubah sesuai dengan modifikasi Gemesne Juhasz et al. (1998). Larutan Kultur diinkubasi selama 8 hari pada 35 ° C pada dar 1 <., Kemudian dipindahkan ke suhu 25 ° C dengan satu fotoperiode 12 h.

Antera ditransplantasi ke dalam 2,4-D-tanaman bebas dengan medium regenerasi yang ditambah dengan 0.1mg /l kinetin (Dumas de Vaulx et al 1981.). Planlet dikembangkan dari embrio yang berakar pada medium honnone-bebas. Regenerasi (R,) tanaman dipotkan. Dan ditanam di rumah kaca untuk aliran cytometry, atau R2 – produksi benih.

Penggandaan kromosom. digunakan untuk pengembangan induksi dihaploid, tunas aksiler dari regeneran haploid dibuang dan 1% w/w colchicine dimasukan pada materi gelling (untuk analisa lebih lanjut).

Aliran Cytometry. Detenninasi dari tingkatan ploidi dilakukan oleh PARTEC Ploidi Analyser. PA-I (Partec Munster, 1 Gennany) dilengkapi dengan lampu dengan tekanan tinggi (Osram HBO-100W / 2) sesuai dengan metode I Dolezel et al (1989) sebelum persiapan sampel. DH-R, selembar daun dicincang dan 1 dimaserasi di LBO1 (1 ml) digunakan untuk analisis buffer agar melepaskan huclei utuh. Supenatan itu disaring melalui suatu CeilTrics dari jenis penyaring nylon dengan ukuran pori-porinya 30 untuk memisahkan sisa-sisa sel. Inti sel diberi label 4′, S’-diamino-2-phenylidole, 14 I J.M, (DAPI, Sigma) berisi larutan buffer LBO1 (1ml). Masing-masing sampel direplikasi dalam tiga ulangan dibandingkan dengan kontrol tanaman (Ro) diploid sebelum penghitungan kromosom (2n =24) pada ujung akar saat persiapan acetocannine .

PCR Study.

– DNA Isolasi. Biji DH-R1 dikecambahkan pada petridish untuk dianalisis molekulnya. Kumpulan genom sampel DNA diekstraksi dari beberapa individu dari sembilan tanaman DH-R1, dan satu kontrol R0 tanaman sebagai donor anthera masing-masing.

Anakan-anakan subjek daun diremas (Ravenel Spec. Inc,) dengan menggunakan 750 IJ.I yang terdapat pada larutan buffer CTAB, diikuti dengan menggunakan metode Dweikat et al (1994),memanfaatkan modifikasi Gyulai et al (1997). Sampel DNA diperlakukan dengan menggunakan enzim RNase, 5I, selama 30 menit pada suhu 37 ‘ C.

– Analisis PCR. Reaksi amplifikasi dijalankan pada volume 25 ~ I oleh CoyTempCyder, 110 SM.  Campuran reaksi berisi 15,625 ~ M masing-masing mengandung deoxynucleotide; 0,05 mM MgCI2: 1,5 U Taq-polimerase (baik menurut Sigma, Promega, atau WestTeam); 24 pM primer (baik menurut SSSR / ISSR atau RAPD / operon Technologies), 2,5 ~ I dari 10 x buffer thermophylic; dan 20 DNA template ~ g. Cairan DNA diukur  sebelumnya dengan spektrofotometer UV-(Jenway 6105) pada OD260 nm.

– PCR-primer. Primer berikut diterapkan, OP / A 1-20 untuk analisis RAPD; (ACTG) 4 dan (GACA) 4 untuk analisis SSR dan CA (GACA) 4, AC (GACA) 4, (GACA) ~ C, (GACA) 4CA untuk analisis ISSR. Campuran reaksi dilapisi dengan setetes minyak mineral (Sigma).

Untuk amplifikasi PCR, 40 cydes dijalankan dengan langkah-langkah berikut:

(1) 20 detik pada 94 ° C untuk denaturasi DNA sebelum suatu pemanasan sampel  pada 84 ° C selama 5 menit,

(2) 20 detik pada 40 ° C untuk anil primer,

(3) 90 menit pada 72 ° C selama reaksi polimerase DNA,

(4) ekstensi akhir pada suhu 72 ° C selama 5 menit, dan terakhir merendam pada 4 ° C sampai sampel dibongkar.

Minimum dipersiapkan tiga DNA independen setiap baris yang digunakan. Masing-masing reaksi sukses dengan pita sc,:>rable yang diulangi setidaknya dua kali. Amplifikasi diuji dengan agarose (1,8%, SeaKem LE, FMC) gel elektroforesis (Owl sistem), diwarnai dengan bromida (1 ~ g / ~ I) di 80 V dalam 1 buffer TAE X dan difoto pada iluminator Tran UV (Pharmacia) oleh kamera Polaroid.

– Fragmen analisis. Ketajaman fragmen PCR diberi skor untuk kehadiran versus absen dari profil. Fragmen PCR dengan intensitas yang rendah hanya memberi skor sebagai kehadiran ketika mereka direproduksi dalam eksperimen ulangan. Suatu pengendalian negatif yang berisi semua komponen PCR diperlukan kecuali template DNA termasuk dalam running PCR.

BAB IV. KESIMPULAN

Penelitian cabe transgenik di Indonesia masih belum begitu berkembang. Sejak tahun 2005 hanya sedikit para ahli yang telah mempublikasikan penelitiannya terkait cabe transgenik ini. Di Indonesia masih terfokus dalam pembuatan gen anti CMV atau CP CMV . Tanaman transgenik belum terpublikasi keberhasilannya di lapangan. Berbeda dengan penelitian dari para pakar di negara maju yang sudah berhasil melihat ketahanan tanaman transgeniknya. Dari sisi kompleksitas peralatan dan methodanya, penelitian yang dilakukan para pakar di negara maju lebih komplek dibandingkan penelitian lokal Indonesia. Namun, ada sedikit kesamaan bahwa Indonesia sudah menggunakan PCR dalam proses penelitian tanaman cabe transgeniknya walaupun dari sisi kinerja lebih sederhana dibandingkan dunia.

DAFTAR PUSTAKA

Batara, Edy. 2005. Kontruksi Gen Cp CMV pada Agrobacterium. Jurusan Kehutanan Fakultas Pertanian Universitas Sumatera Utara : Medan

Batara, Edy. Dkk. 2005 Rekayasa Genetika Tanaman Cabai (Capsicum annuum L) Tahan Virus Mozaik Ketimun (CMV). Laboratorium Bioteknologi Fakultas Pertanian Universitas Sumatera Utara. Medan

Kim, SJ. Dkk.1997. Satellite-RNA-mediated resistance to cucumber mosaic virus in transgenic plants of hot pepper (Capsicum annuum cv. Golden Tower)”. Department of Vegetable Crop, University of California, Davis,  USA

G, Gyulai.dkk. 1999. PCR-ANALYSIS OF F1 HYBRID DERIVED DH PEPPER LINES).  Vegetable Crops Research Institute, Budapest, Hungary.

Tentang rijalazam

I am a biologist Like about all problem on biology not just that, but I also have hobbies as jurnalist, politikus, teacher, religius and trainer motivation. Like it if can do all that !!! Gombate!!! Happy to introduce u, SUNANDAR,S.Si
Pos ini dipublikasikan di Uncategorized. Tandai permalink.

Tinggalkan Balasan

Isikan data di bawah atau klik salah satu ikon untuk log in:

Logo WordPress.com

You are commenting using your WordPress.com account. Logout / Ubah )

Gambar Twitter

You are commenting using your Twitter account. Logout / Ubah )

Foto Facebook

You are commenting using your Facebook account. Logout / Ubah )

Foto Google+

You are commenting using your Google+ account. Logout / Ubah )

Connecting to %s