Mengembalikan khittah sistem madrasah di pesantren

Dipublikasi di Uncategorized | Meninggalkan komentar

Penemuan Prion, Motivasi Buka Tabir Alam Ghaib

Sudah diterbitkan secara bersambung pada Harian Jambi Ekspress tanggal 17 & 21 November 2009

Pasca penemuan Prion oleh ahli biologi Amerika Serikat (AS) Stanley Prusiner tahun 1997 telah membuka kebuntuan stagnasi sains selama 60 tahun lebih yang selama ini menganggap virus sebagai makhluk paling kecil di dunia. Virus dengan ukuran rata-rata 0,02 – 0,03 mikron meter (baca : 0,00000002 – 0,00000003 meter ) ternyata masih kalah lebih kecil lagi dari dua hasil penemuan Stanley yaitu viroid dan prion. Ukuran jenis viroid lebih kecil dari virus tapi masih kalah lebih kecil lagi dibandingkan prion. Namun kedua makhluk ini mempunyai sifat yang sama dengan virus yaitu sama-sama patogen (baca: parasit yang menimbulkan penyakit) pada makhluk hidup lain seperti manusia, hewan dan tumbuhan.

Penulis disini tidak bermaksud menjelaskan secara mendetail apa yang ditemukan oleh Stanley tersebut tapi sedikit memotivasi kita semua bahwa sedikit demi sedikit tabir alam ghaib (alam yang tak mampu dilihat kasat mata) semakin terkuak oleh teknologi manusia. Mulai dari penemuan bakteri, virus, viroid dan prion adalah suatu hasil penemuan yang sulit dilihat dengan mata normal manusia tapi membutuhkan alat canggih yang mampu memperbesar sekian ratus bahkan ribuan kali dari ukuran sebenarnya.

Pertanyaan ini tentu sangat menggelitik bagi kita terlepas dari pemahaman keagamaan manapun, namun secara logika penemuan-penemuan manusia memang semakin mengungkit keberadaan alam ghaib di sekitar kita. Alam ghaib tidak selalu diartikan sebagai alamnya jin dan para malaikat tapi dari asal katanya, definisi ghaib lebih dekat kepada alam yang sangat halus yang tidak bisa dilihat dengan mata telanjang (mata manusia normal). Dengan pembuktian keberadaan alam ghaib secara IPTEK tentu akan menambah motivasi keimanan bagi insan yang beragama dalam mengamalkan perintah tuhannya.

Penemuan-penemuan dari hasil IPTEK melalui bantuan mikroskop telah banyak membantu manusia mengetahui adanya alam lain di luar kasat mata manusia. Awal mulanya pada masa Aristoteles, manusia hanya mengenal kerajaan makhluk hidup atas dua dunia (kingdom) saja yaitu kingdom animalia (hewan) dan kingdom plantae (tumbuhan). Seiring perkembangan IPTEK, pendapat ini terus mengalami pergeseran melalui penemuan mikroskop dan kemajuannya.

Masa Ernst Haekel, kingdom makhluk hidup menjadi lebih bertambah atas empat kingdom yaitu; animalia, plantae, protista dan monera. Kelompok Protista merupakan kelompok yang memiliki membran inti sel (eukaryotik) dan umumnya bersel banyak tapi tidak mempunyai jaringan yang sudah terspesialisasi. Diantaranya diwakili oleh berbagai jenis amuba, plasmodium, euglena dan alga. Sedangkan kelompok Monera merupakan kelompok yang belum memiliki membran inti sel (prokaryotik) dan bersel satu yang diwakili oleh berbagai jenis Bakteri dan Cyanobacteria.
Masa Ernst Haekel, kingdom makhluk hidup menjadi lebih bertambah atas empat kingdom yaitu; animalia, plantae, protista dan monera. Kelompok Protista merupakan kelompok yang memiliki membran inti sel (eukaryotik) dan umumnya bersel banyak tapi tidak mempunyai jaringan yang sudah terspesialisasi. Diantaranya diwakili oleh berbagai jenis amuba, plasmodium, euglena dan alga. Sedangkan kelompok Monera merupakan kelompok yang belum memiliki membran inti sel (prokaryotik) dan bersel satu yang diwakili oleh berbagai jenis Bakteri dan Cyanobacteria.

Penemuan bakteri dan cyano bakteria ini sangat berbeda dari makhluk hidup lainnya karena tidak dilakukan melalui mata telanjang tapi melalui mikroskop yang dibuat pertama kali oleh Antonie Van Leuwenhock pada abad ke-19. Awal pembuatan, perbesarannya baru mencapai sekitar 40 kali hingga 400 kali tapi sudah mampu melihat bakteri yang berukuran panjang 1-10 mikron meter dan lebar 0,7-1,5 mikron meter.

Pada awal abad 20, mikroskop semakin terus dikembangkan hingga mencapai perbesaran 500 ribu kali dari ukuran sebenarnya. Hal ini merangsang ilmuwan untuk menemukan makhluk yang lebih kecil dari bakteri yaitu dengan ditemukannya virus. Meskipun cikal-bakal penemuan virus sudah terjadi tahun 1883 oleh Adolf Meyer namun kepastian pembuktian baru dilakukan tahun 1935 oleh Wendel Stanley. Mikroskop pada masa ini sudah jauh beda bentuknya dari apa yang dirancang oleh Antonie Van Leuwenhock dimana sudah beralih dari mikroskop cahaya ke mikroskop elektron.

Penemuan virus juga telah menghancurkan pendapat ilmuwan yang selama ini menganggap bahwa setiap makhluk yang hidup terdiri atas sel. Faktanya virus bukanlah sel tapi hanyalah terdiri atas asam nukleat (DNA/RNA) saja yang dibungkus oleh kapsid (protein). Selain itu, virus memiliki kekebalan terhadap antibiotik dan alkohol yang berbeda dengan sifat bakteri.

Tidak berhenti sampai disitu saja, mikroskop elektron terus mengalami perkembangan pesat dari sisi kemampuan perbesaran. Mikroskop Elektron terbaru saat sekarang sudah mampu melihat objek pengamatan dengan perbesaran sampai satu juta kali. Hasilnya, tahun 1997 kembali dunia dikejutkan dengan penemuan makhluk yang lebih kecil dari virus dan lebih ganas lagi yaitu viroid dan prion. Viroid berhasil ditemukan pada tanaman kelapa yang telah merusak dan mematikan lebih satu juta tanaman kelapa di Philipina. Sedangkan prion ditemukan pada jaringan otak sapi yang menimbulkan penyakit sapi gila di Washington, Amerika Serikat. Prion berukuran sangat kecil dari viroid dan virus. Bahkan sifat ganasnya juga sangat luar biasa karena menyerang jaringan syaraf pada hewan dan manusia. Pada manusia, prion telah menimbulkan penyakit kuru, yaitu kelumpuhan tiba-tiba pada suatu anggota keluarga hingga kematian dalam rentang waktu 3-12 bulan.

Virus yang tubuhnya mengandung DNA dan RNA ternyata sangat jauh berbeda dengan makhluk baru yang ditemukan ilmuwan peraih nobel ini. Viroid hanya mengandung potongan molekul RNA saja. Bahkan perbedaan yang sangat jauh terjadi pada prion yang tidak memiliki DNA dan RNA (baca: asam nukleat) sama sekali tapi memiliki kemampuan berkembang biak. Prion hanyalah sejenis protein yang memiliki kemampuan menginfeksi sel inangnya. Prion juga memiliki ketahanan terhadap radiasi, sterilisasi dan deterjen dimana kelompok virus tidak memiliki ketahanan terhadap semua itu.

Keberhasilan Stanley Prusiner menemukan viroid dan prion sama dengan proses Dimitri Ivanowsky dalam menemukan virus pada penyakit mozaik tanaman tembakau yang diduga disebabkan oleh bakteri yang lebih kecil sebelumnya sampai akhirnya terbukti adanya makhluk jenis baru yang bernama virus. Sedikit berbeda dengan Stanley, semula dirinya menduga viruslah yang menimbulkan penyakit pada sapi gila dan tanaman kelapa di Philipina tapi setelah adanya pemakaian mikroskop elektron yang lebih canggih dari sebelumnya ternyata ditemukan makhluk yang lebih kecil dari virus, yaitu viroid dan prion.

Dari paparan penulis tentang proses penemuan makhluk tidak kasat mata diatas (bakteri, virus, viroid dan prion) dan perkembangan perbesaran mikroskop terkini, mungkinkah akan ditemukan lagi makhluk-makhluk yang lebih halus lagi dari viroid dan prion. Jika masa sekarang perbesaran mikroskop baru mencapai satu juta kali, mungkinkah 50 tahun atau 100 tahun yang akan datang perbesaran mikroskop akan lebih canggih lagi. Tentu teknologi mikroskop akan terus mengalami perkembangan dan kamajuan.

Lantas timbul pertanyaan di hati kita, mungkinkah manusia mampu melihat alam jin dan alam malaikat yang dalam pandangan ilmu agama berada pada alam ghaib, jika perbesaran mikroskop sudah mencapai titik klimaks yang memungkinkan. Pertanyaan ini tentu bukan dituju pada kita sekarang yang seakan tertawa sinis menjawabnya. Tapi anak-anak cucu kitalah nanti yang akan menjawabnya. Tugas kita saat ini hanyalah merangsang cara berpikir mereka untuk tidak cepat puas dengan apa yang telah ditemukan dan dihasilkan IPTEK masa sekarang.

Merangsang cara berpikir untuk mengungkap alam ghaib adalah sah-sah saja dalam dunia intelektual. Justru sikap seperti itu harus dimotivasi kepada anak-anak didik di sekolah agar mampu lebih banyak melakukan penemuan-penemuan baru dan mengungkap semua rahasia sang pencipta di atas dunia ini. Sudah selayaknya, seiring perkembangan IPTEK ini manusia semakin dekat dan tunduk pada Tuhan Sang Penciptanya, betapa sangat luar biasanya segala apa yang diciptakannya di alam ini. Dari makhluk paling kecil hingga terbesar mampu hidup secara sempurna di dunia ini.

Dipublikasi di Uncategorized | Meninggalkan komentar

Kajian Biologi, Jilbab Bukti Kemajuan Nilai Islam

Sudah diterbitkan pada Harian Jambi Ekspress 9/10/2009 atas nama Sunandar,S.Si

Banyak kalangan muslimah yang pro dan kontra jika disuruh berjilbab sesuai tuntunan syariah Islam. Beragam dalih digunakan untuk membenarkan prilaku yang mereka lakukan. Kalangan pro beranggapan wajib bagi kaum wanita yang mengaku dirinya muslimah untuk berjilbab sesuai dengan perintah yang tercantum dalam al quran dan hadist.

Jika tidak dilakukan, maka muslimah tersebut dianggap berlaku dosa pada dirinya dan juga orang lain (baca: kaum laki-laki) yang telah diberi kebebasan cuma-cuma melihat auratnya. Sementara itu, kalangan kontra beranggapan persoalan jilbab adalah persoalan pribadi. Lagipula negara Indonesia bukanlah negara agama dimana segala sesuatu yang berbau syariat harus diterapkan pada setiap individu muslim.Sebenarnya persoalan jilbab bukanlah persoalan agama semata tapi juga merupakan salah satu persoalan identitas kemajuan makhluk hidup dalam pandangan ilmu biologi. Evolusi yang merupakan salah satu cabang ilmu biologi menyatakan suatu makhluk hidup akan memiliki tingkat kemajuan peradaban yang tinggi jika salah satunya adalah organ-organ reproduksinya semakin terlindungi dari dunia luar.

Pada tingkatan kingdom plantae (kerajaan tumbuhan), kelompok angiospermae (tumbuhan berbiji tertutup) merupakan kelompok yang dianggap paling maju karena organ-organ reproduksinya tertutup oleh bunga. Sedangkan pada kingdom animalia (kerajaan hewan), manusia merupakan spesies yang paling maju diantara spesies lain-lainya. Dalam hal ini, jilbab merupakan suatu kiasan lapisan pelindung bagi manusia teriutama kaum muslimah agar organ-organ yang menjadi penarik rangsangan seksual terlindung dari gangguan dunia luar.

Dalam ilmu biologi, evolusi merupakan cabang ilmu yang mempelajari perubahan makhluk hidup mulai dari tingkat paling sederhana hingga tingkat yang paling kompleks untuk mencapai tingkat yang paling maju diantara mahkluk lainnya. Dalam ilmu evolusi ini, kelompok tumbuhan primitif diwakili oleh bangsa lumut.

Hal ini disebabkan bangsa lumut belum memiliki organ pelindung yang komplek untuk melindung bagian archegonium (kelamin betina) dan anteridium (kelamin jantan) yang hanya baru terdapat pada tubuh bagian atas. Posisinya yang terlihat dari dunia luar mempermudah air untuk membantu proses perkawinan secara terbuka dengan mengantarkan serbuk anteridium ke bagian archegonium.

Setelah bangsa lumut, kelompok yang agak lebih maju adalah bangsa paku. Kelompok ini berkembang biak dengan spora yang terletak pada posisi bagian bawah daun khusus yang disebut daun sporofil. Walaupun sudah agak terlindung pada bagian atasnya tapi bagian bawahnya masih terbuka dengan dunia luar sehingga paku dianggap masih tergolong kelompok primitif bersama dengan lumut.

Tingkatan mahkluk yang lebih maju dari lumut dan paku adalah dari kelompok Gymnospermae (tumbuhan berbiji terbuka). Contoh tumbuhan ini adalah; pakis haji, melinjo, pinus, dan damar. Kelompok angiospermai ini berkembang biak dengan biji yang terletak terselip pada daun khusus yang dikenal dengan strobillus (daun buah). Dibandingkan dengan lumut dan paku, posisi biji pada strobillus lebih agak terlindung dari dunia luar, walaupun masih ada celah udara sedikit diantara lembaran-lembaran strobillus.

Berbeda dengan tumbuhan Angiospermae (tumbuhan berbiji tertutup), posisi biji benar-benar terlindung secara khusus melalui organ bunga. Contoh tumbuhan ini diwakili oleh tumbuhan dikotil dan monokotil seperti mangga, durian, pinang, dan sebagainya. Posisi biji terbentuk pada tanaman ini saat bagian ovary yang tersimpan dalam putik (sel kelamin betina) bertemu dengan serbuk sari yang dilepaskan oleh benang sari (sel kelamin jantan).

Pertemuan berlangsung tertutup melalui suatu pembuluh khusus sepanjang bagian dalam putik. Tidak hanya dilindungi oleh lapisan putik, organ pelindung lain yang ikut berperan adalah lembaran-lembaran mahkota dan kelopak. Lembaran-lembaran ini juga melindungi benang sari bersama dengan putik dari dunia luar. Keberadaan bunga dengan lembaran-lembaran mahkota dan kelopaknya sebagai pelindung sel-sel reproduksi merupakan suatu bukti kemajuan tumbuhan angiospermae dibandingkan kelompok tumbuhan lainnya.

Dalam dunia hewan posisi manusia juga dianggap paling maju karena memiliki bobot otak yang lebih besar dibandingkan hewan lain. Bobot otak secara tidak langsung akan mempengaruhi tingkat kecerdasan makhluk hidup. Dengan kecerdasan yang dimilikinya, manusia mempunyai kemampuan mandiri untuk menutupi bagian tubuhnya yang sensitif.

Pada masa lalu, homo erektus (manusia kera) dan manusia purba lainnya baru mampu sebatas menutupi bagian bawah perutnya dengan memakai pelindung sejenis koteka. Pada masa homo sapiens (manusia modern) seperti saat sekarang ini manusia sudah memakai pakaian khusus yang menutupi seluruh bagian tubuhnya yang sensitif. Meskipun masih ada sebagian komunitas yang memakai koteka dalam kehidupannya, namun dalam pandangan sosial dianggap masih terbelakang. Pada masa homo sapiens ini nilai etika dan perasaan malu menjadi aturan hidup dalam pergaulan. Hal-hal sensitif yang berbau reproduksi (baca: aurat) harus ditutup agar tidak memancing kriminalitas dalam kehidupan sosial.

Bagaimanakah dengan persoalan jilbab ? Jilbab dalam kamus Bahasa Indonesia terbitan Departemen Pendidikan Nasional adalah kerudung lebar yang menutupi kepala, leher dan dada. Walaupun sedikit berbeda definisinya oleh sebagian ahli fiqh, jilbab merupakan pakaian yang menutupi seluruh tubuh wanita yang dianggap aurat dalam pandangan Islam.

Namun tak dapat dipungkiri, bahwa rambut, leher dan dada termasuk bagian yang sangat sensitif atau penarik dalam pandangan kaum pria. Karena dianggap penarik bagi lawan jenis maka dalam ilmu biologi dianggap merupakan organ-organ reproduksi yang seharusnya dilindungi dari dunia luar. Sama halnya dengan putik dan benang sari, karena merupakan bagian terpenting dalam perkawinan serbuk sari dan ovary (bagian dalam putik) untuk membentuk biji maka oleh mahkota dan kelopak bagian tersebut tetap dilindungi oleh tumbuhan angiospermai.

Jika melihat perkembangan zaman akhir-akhir ini, secara IPTEK sudah memiliki tingkat kemajuan yang tinggi dibandingkan masa sebelumnya. Hanya saja perkembangan IPTEK tersebut tidak diiikuti manusia dengan perkembangan nilai sosial dan etikanya dalam kehidupan yang berdampak pada tingginya angka kriminalitas dalam kehidupan. Alam telah memberikan gambaran betapa pentingnya makhluk hidup melindung secara rapat organ-organ reproduksinya dari dunia luar agar terhindar dari hal-hal yang membahayakan hidupnya.

Namun pemikiran seperti ini belum dipahami secara mendalam oleh manusia secara keseluruhan sebagai tingkat yang paling maju melihat persoalan alam sekitarnya. Islam ternyata telah mempunyai aturan khusus bagi umatnya untuk menjalani kehidupan. Bagi kaum laki-laki dan wanita punya batasan tertentu yang dianggap organ-organ reproduksinya (aurat).

Wanita Islam atau muslimah punya aturan khusus lagi perlunya memakai jilbab setiap bertemu dengan orang yang bukan pihak keluarganya. Jika mereka ingin menikah, ada aturan khusus yang harus dilakukan dengan menemui pihak orang tuanya. Sama dengan halnya serbuk sari yang hendak menemui ovary. Perlu jalan khusus yang telah disediakan sepanjang putik sehingga tidak terjadi gangguan dari dunia luar.

Tentunya manusia lebih maju dari tumbuhan angiospermae dari sisi etika, rasa malu dan pergaulan sosial sehingga sudah seharusnya manusia mampu mempelajari semua yang terjadi tersebut. Mempelajari untuk kemaslahatan dalam perjalanan hidupnya diatas muka bumi ini. Segala sesuatu yang berbau aurat sudah selayaknya ditutup seperti yang dilakukan oleh tumbuhan angiospermae sebagai tumbuhan yang dianggap paling maju. Mampukah manusia mengalahkan kemajuan angiospermae, semuanya dikembalikan pada individu masing-masing untuk memposisikan dirinya sendiri.

Dipublikasi di Uncategorized | Meninggalkan komentar

Pembuatan Tempoyak (ASAM DURIAN)

Oleh. Sunandar,S.Si
Mahasiswa Pasca Sarjana Biologi UNAND PADang

PEMBUATAN TEMPOYAK (ASAM DURIAN)

BAB I. PENDAHULUAN

Tempoyak merupakan suatu jenis makanan tradisional yang dibuat dari hasil fermentasi buah durian. Makana ini sudah menjadi ciri khas banga melayu. Walaupun beberapa daerah menggunakan penamaan yang berbeda seperti, pekasam (Aceh) dan asam durian (Sumatera Barat), tapi pada hakikatnya berasal dari makanan yang sama yaitu tempoyak. Pemakaian istilah tempoyak sendiri sudah cukup familiar di daerah Sumatera Bagian Selatan (Jambi, Sumatera Selatan dan Bengkulu). Penyebaran oleh suku keturunan melayu terhadap makanan tradisional ini cukup luas yaitu; Sumatera, Kalimantan dan Malaysia. (Wikipedia, 2010)
Di Malaysia sendiri, dalam hikayat abdullah makanan ini menjadi makanan sehari-hari penduduk Terengganu. Ketika Abdullah bin Abdulkadir berkunjung ke Terengganu (sekitar tahun 1836), dia menyatakan bahwa salah satu kegemaran penduduk setempat adalah tempoyak. Sejarah dalam hikayat ini menyebutkan tempoyak merupakan makanan khas dari malaysia.
Tempoyak memiliki peran yang cukup penting di tengah masyarakat keturunan melayu. Pada saat terjadinya musim durian, pembuatan tempoyak merupakan salah satu alternatif mengawetkan buah ini agar dapat digunakan untuk kebutuhan lain pada waktu tertentu. Fungsi pengawetan ini sangat bagus untuk menghindari pembusukan buah yang tidak diinginkan. Menurut Yuliana (2009), tempoyak mempunyai umur simpanan yang relatif cukup lama hingga musim durian berikutnya. Selain berfungsi penting dalam pengawetan, juga berfungsi sebagai penyedap makanan secara alami. Pemberian tempoyak terhadap beberapa sambal dan gulai akan menambahkan cita rasa suatu untuk dimakan.
Buah durian yang menjadi bahan utama dalam pembuatan makanan tradisional ini memiliki kandungan gizi dan khasiat yang cukup tinggi. Hasil penelitian ilmiah menyatakan bahwa durian mengandung unsur Sodium, kabrohidrat, serat, protein, kalsium, fosfor, karoten, potassium, zat besi, vitamin C, thiamin, niacin, riboflavin, vitamin B1, B2, dan vitamin C serta kalium, dan fosfor. Sedangkan khasiatnya adalah mencegah faktor penuaan dari luar, meningkatkan tekanan darah (zat besi), buah dan akarnya juga digunakan untuk mengatasi bengkak, penyakit kulit, dan penyakit kuning (Wulandari, 2010).
Tempoyak merupakan makanan hasil fermentasi sebagai salah satu upaya pengawetan pangan secara tradisional. Tempoyak mempunyai aroma yang tajam dan rasanya sangat asam dan digolongkan sebagai makanan hasil fermentasi asam laktat. Fermentasi durian serupa dengan fermentasi sauerkraut (asinan kubis), ”kimchi” dan asinan buah yaitu fermentasi dengan menambahkan garam dapur pada konsentrasi tertentu yang dapat mendukung aktivitas bakteri asam laktat. (Yuliana, 2009).
Sebagai makanan hasil fermentasi, pembuatan tempoyak melibatkan sejumlah mikroorganisme penghasil asam laktat atau lebih dikenal dengan bakteri asam laktat (BAL). BAL yang membentuk koloni disini adalah Lactobacillus casei sub sp rhamnosus dan Lactobacillus fersantum (Ekowati,1998).
Dua BAL tersebut memiliki karakter persamaan dan perbedaan masing-masingnya dalam proses terbentuknya asam-asam organik pada tempoyak. Lactobacillus casei memiliki karakter bersifat heterofermentatif, selama proses pembuatan tempoyak mampu meningkatkan kadar asam laktat hingga 7 hari penyimpanan, produksi asam asetatnya rendah, dan memiliki kemampuan menghambat pertumbuhan bakteri Eschericia coli dengan mengeluarkan bakteriosin.
Lactobacillus fersantum sebagian juga memiliki karakter sama dengan Lactobacillus casei. Seperti, punya kemampuan dalam menghambat pertumbuhan bakteri Eschericia coli dengan mengeluarkan bakteriosin. Meski juga bersifat heterofermentatif tapi hal tersebut tidak berlaku mutlak atau lebih dikenal dengan fakultatif heterofermentatif. Karakter yang sedikit berbeda dalam hal kemampuan menghasilkan asam laktat, Lactobacillus fersantum mempunyai kemampuan paling lama hanya 5 hari penyimpanan. Sedangkan kemampuan menghasilkan asam asetat, lebih tinggi dari pada bakteri lactobacillus casei (Satria Nur, 2005).
Lactobacillus casei dalam proses fermentasi tempoyak menghasilkan senyawa asam organik seperti; asam laktat, asam butirat, asam asetat dan asam propionat. Sedangkan Lactobacillus fersantum hanya membentuk asam laktat dan asam asetat. Selain itu, bakteri asam laktat heterofermentatif mampu menghasilkan enzim glukosa-6-fosfat dehidrogenase dan enzim 6-fosfoglukonat dehidrogenase, sedangkan bakteri asam laktat fakultatif heterofermentatif menghasilkan enzim-enzim fruktosa difosfat aldolase selain kedua enzim yang terdapat pada heterofermentatif (Anonimus).
Hasil penelitian Ekowati (1998) menyebutkan selama berlangsungnya fermentasi pada proses pembutan tempoyak akan terbentuk asam-asam organik meliputi asam butirat 7,3 % untuk substrat daging buah kuning dan 6,2 % untuk substrat daging buah putih, asam laktat 1,6% (daging buah putih) dan 1,7 % (daging buah kuning). Kadar asam asetat 0,34 % untuk daging buah putih dan 0,27 % untuk daging buah kuning, serta kadar asam malat dan sitrat kurang dari 0,01 %. Sejauh ini belum ada informasi tentang kemampuan pembentukan asam organik baik jumlah dan jenisnya oleh masing-masing isolat bakteri asam laktat
Bakteri asam laktat heterofermentatif mampu menghasilkan enzim glukosa-6-fosfat dehidrogenase dan enzim 6-fosfoglukonat dehidrogenase, sedangkan bakteri asam laktat fakultatif heterofermentatif menghasilkan enzim-enzim fruktosa difosfat aldolase selain kedua enzim yang terdapat pada heterofermentatif.

BAB II. METODA PENELITIAN
2.1. Alat dan Bahan
Peralatan yang digunakan dalam pembuatan tempoyak sangat sederhana sekali. Alat yang umumnya digunakan adalah pisau untuk membuka durian dan memisahkan daging buah dari bijinya. Serta toples atau wadah penampung yang mempunyai tutupan sebagai tempat penyimpanan daging buah yang sudah dipisahkan.
Adapun bahan-bahan yang digunakan adalah; daging buah durian (Durio zibethenus) yang sudah dipisahkan dari dagingnya. Garam dan cabe rawit secukupnya untuk ditaburkan pada daging buah. Pemakaian garam bukan suatu hal yang mutlak karena sebagian masyarakat juga banyak tidak menggunakannya menghindari terjadinya keasinan. Namun menurut Amin (2004), pemakaian garam secukupnya (1,3%) akan mempercepat terjadinya proses pertumbuhan Bakteri Asam Laktat. Sedangkan pemakaian cabe rawit secukupnya bertujuan untuk mempercepat terjadinya reaksi fermentasi asam laktat pada tempoyak.
2.2. Cara Kerja
Terlebih dahulu disiapkan sejumlah buah durian (Durio zibethenus ) yang sudah matang. Bukalah buah durian dengan menggunakan pisau dan pisahkan daging buah dari bijinya. Setelah daging buah terpisah masukkan daging buah tersebut ke dalam toples atau wadah yang bisa ditutup. Taburkan garam dan cabe rawit yang sudah digiling secukupnya. Kemudian toples yang berisi daging buah durian tersebut disimpan pada ruang dengan suhu kamar (36-37’ C). Lakukan penyimpanan selama 5 hingga 7 hari untuk hasil produk tempoyak yang bagus.
Waktu yang dibutuhkan dalam penyimpanan ini sebenarnya sangat fleksibel tapi standar yang bagus adalah sekitar 5 hingga 7 hari tersebut. Hal ini disebabkan pada hari tersebut kadar asam laktat dalam kondisi tinggi, sedangkan lewat dari 7 hari sudah berubah menjadi asam organik lain oleh bakteri fermentasi.

BAB III. TAHAPAN REAKSI KIMIA PADA TEMPOYAK
Reaksi kimia yang terjadi dalam proses pembuatan tempoyak adalah reaksi fermentasi asam laktat hetero fermentatif. Artinya, selama proses terbentuknya produk tempoyak tidak hanya menghasilkan asam laktat saja (homfermentatif) tapi juga menghasilkan produk asam organik lainnya. Diantara produk asam organik tersebut adalah; asam asetat, asam propionat dan CO2.
Dalam proses reaksi fermentasi, senyawa glukosa yang terdapat di dalam daging durian akan diubah oleh Bakteri Asam Laktat (BAL) yaitu; Lactobacillus casei dan Lactobacillus fersantum menjadi gkulosa-6-P. Kemudian diubah menjadi Gluconat-5P dan berubah lagi menjadi Xilose 5-P-CO2. Xilose-5-P-CO2 nantinya akan terurai menjadi dua senyawa yaitu; Trose-3P dan Acetyl P.
Senyawa Trose-3P akan diubah menjadi senyawa asam piruvat. Kemudian barulah diubah lagi menjadi senyawa asam laktat. Diperkirakan kemampuan menghasilkan asam laktat ini berlangsung sekitar 5 hingga 7 hari. Beberapa hari berikutnya, barulah senyawa ini akan terurai menjadi asam propionat, asam asetat dan CO2. Berikut alurnya secara lengkap:

(Gula) Glukosa glukosa-6- P Gluconat -5P

Xilose-5-P-CO2

Trose-3P Acetyl P

As. Piruvat

As. Lactat

3CH3-CHOH-COOH (As. laktat) 2CH3-CH2-COOH (propionat) +

CH3-COOH (asetat) + CO2 + H2O

Gambar 1. Bagan alur reaksi kimia terbentuknya tempoyak

Tempoyak yang bagus berlangsung pada saat kadar asam laktat masih berada dalam kosentrasi yang tinggi. Peningkatan kosentrasi asam laktat berlangsung setelah penyimpanan selama 5 hingga 7 hari. Setelah lewat 7 hari, asam organik lain seperti asam propionat dan asam asetat akan mengalami peningkatan kosentrasi nantinya.

BAB IV. FAKTOR NON TEKNIS YANG MEMPENGARUHI

Tempoyak yang bagus adalah yang sesuai dengan standar Departemen Kesehatan. Standar Departemen Kesehatan untuk tempoyak yang bagus adalah:
1. Organoleptik
Uji organoleptik adalah pengujian makanan tempoyak dengan menggunakan organ panca indra. Standar aroma yang bagus untuk tempoyak adalah berkisar pada nilai 3, 22. Standar warnanya sekitar 3,31 dan standar rasanya dengan nilainya 3, 23. (Hanum, 2008)
2. pH
Nilai keasaman yang bagus untuk tempoyak adalah berkisar pada pH 3 – 4. Tingkat keasaman akan berbeda seiring dengan lamanya penyimpanan. Menurut Amin (2004), hubungan antara keasaman dengan waktu fermentasi dapat dilihat pada grafik dibawah ini:
Jika kita lihat grafik tersebut maka lama penyimpanan sangat mempengaruhi kadar keasaman. Penyimpanan dibawah 4 hari akan menyebabkan nilai PH masih berkisar antara 4,5 sampai 7.
3. Kadar air
Kadar air adalah kandungan air yang standar yang terdapat didalam makanan tempoyak. Standar departemen kesehatan untuk kadar air adalah sebesar 53,8 %.
4. Lama penyimpanan
Penyimpanan yang terlalu lama dapat mempengaruhi kadar keasaman yang terdapat dalam tempoyak. Penyimpanan yang kurang dari 5 hari biasanya kadar keasamannya masih rendah. Sedangkan jika disimpan lebih diatas 7 hari akan menyebabkan keasaman tempoyak akan mengalami perubahan juga. Jika disimpan diatas 5 hingga 7 hari, maka kadar keasaman dari asam laktat akan mengalami penurunan sehingga standar kesehatan tidak terpenuhi.

BAB V. KESIMPULAN

Tempoyak merupakan makanan tradisional khas suku melayu yang berasal dari hasil fermentasi daging buah durian. Fermentasi Asam laktat yang bersifat heterofermentatif ini melibatkan kinerja dari BAL seperti; Lactobacillus casei sub sp rhamnosus dan Lactobacillus fersantum. Hasil penelitian menurut Departemen Kesehatan (Depkes) bahwa tempoyak yang bagus adalah jika disimpan dalam waktu sekitar 5 hingga 7 hari. Dengan pH berkisar 3-4. Kadar air 53, 8 %. Sedangkan uji organoleptiknya adalah standar aroma yang bagus adalah berkisar pada nilai 3, 22. Standar warnanya sekitar 3,31 dan standar rasanya dengan nilainya 3, 23

DAFTAR PUSTAKA
Anonimous.Teori Dasar.
Amin, Amiza Mat, Zakiah Jaafar, Ng Lay Khim. 2004. Effect of Salt On Tempoyak Fermentation and Sensory Evaluation. Journal Of Biological Sciences 4 (5):650 -653. Malaysia
Ekowati, Christina Nugroho.2009. Potensi Daya Antibakteri Isolat Lactobacillus Dari Tempoyak Terhadap Eschericia coli The Potential Ability Of Antibacterial Isolates Lactobacillus From Tempoyak to Eschericia coli. Biologi FMIPA UNILA. Bandar Lampung.
Hanum, Laila,dkk. 2008. Teknik Sederhana Pembuatan Tempoyak Durian Yang Sehat Dan Bergizi. Lembaga Pengabdian Kepada Masyarakat. Universitas Sriwijaya. Palembang.
Nur, Hasrul Satria.2005. Pembentukan Asam Organik Oleh Isolat Bakteri Asam Laktat Pada Media Ekstrak Daging Buah Durian (Durio Zibethinus Murr).. Jurnal BIOSCIENTIAE Volume 2, Nomor 1, Januari 2005, Halaman 15-24
Triwulandari. 2004. Pembuatan Tempoyak
Wikipedia.2010. Tempoyak.http://www.wikipedia.com

Yuliana, Netti. 2009. Ilmu Dan Teknologi Pengolahan Durian Fermentasi (Tempoyak). UNILA. Bandar Lampung
.

.

Dipublikasi di Uncategorized | Meninggalkan komentar

Bioteknologi Tanaman Cabe Resisten CMV

BAB I. PENDAHULUAN

1.1. Latar Belakang

Tanaman cabe memiliki tingkat permintaan yang cukup tinggi di tingkat konsumen. Berdasarkan data BPS tahun 1999, laju permintaan terhadap tanaman ini terus mengalami peningkatan 13 % setiap tahun. Tingginya laju permintaan ini tidak berbanding lurus dengan produktifitas pengembangan tanaman cabe di Indonesia. Posisi Indonesia masih posisi terendah di Asia tenggara disebabkan produktifitas cabenya hanya menghasilkan 2,6 ton/tahun dibandingkan rata-rata produktifitas Asia tenggara yang berkisar 8- 9 ton./tahun.

Rendahnya suatu produktifitas cabe tidak bisa disebabkan keterbatasan lahan. Namun hal yang lebih penting adalah kemampuan petani dalam meningkatkan produktifitas pada lahan yang terbatas. Kemampuan menyeleksi benih, teknik budidaya yang bagus serta kemampuan dalam pemberantasan hama dan penyakit menjadi kunci dalam meningkatkan laju produktifitas cabe di pasaran. Penggunaan cabe dengan tahan terhadap hama dan penyakit serta produksi panen yang tinggi menjadi solusi terbaik.

Keberadaan tanaman transgenik sudah semakin tak asing lagi di tengah masyarakat yang hidup dengan ilmu pengetahuan dan teknologi yang tinggi masa sekarang. Berbagai tanaman transgenik sudah diciptakan untuk berbagai tanaman budidaya, salah satunya adalah terhadap tanaman cabe (Capsicum annuum) transgenik

Cabe transgenik adalah salah satu jenis tanaman yang sudah mengalami rekayasa genetika dari sisi bentuk dan kualitasnya melalui penyisipan gen atau DNA hewan, tumbuhan, bakteri, virus dan mikroba lainnya dengan tujuan tertentu.  Penyisipan gen ke dalam tanaman ini disebabkan gen yang disisipkan mempunyai keunggulan tertentu sehingga mampu meningkatkan pemuliaan tanaman yang disisipkan. Keunggulan yang didapatkan diantaranya adalah tanaman memiliki ketahanan terhadap hama, tahan cuaca, umur lebih pendek untuk panen, kualitas yang bagus dan kandungan nutrisinya yang lebih tinggi. Dengan demikian kebutuhan pangan akan cepat tersedia dengan penghematan biaya yang lebih rendah dari tanaman yang bukan transgenik. (Ayu, 2009).

Kemajuan tanaman cabe transgenik tidak terlepas dari kemajuan IPTEK yang dimiliki suatu bangsa. Dari sisi kemajuan bioteknologi tanaman secara umum, Indonesia masih berada pada gelombang I dan sedang menuju ke gelombang II, dibandingkan dengan negara-negara maju seperti Amerika Serikat, Canada, Argentina, China dan negara-negara eropa yang sudah berada pada gelombang III. Gelombang I secara umum menunjukan bahwa hasil produk transgenik masih terfokus pada penciptaan ketahanan tanaman terhadap cekaman biotik dan abiotik. Berbeda dengan gelombang II yang sudah mencakup kepada kajian secara medis. Sedangkan gelombang III sendiri sudah memfokuskan pada peningkatan kandungan nutrisi pada suatu tanaman.

Indonesia masih sangat kurang dalam melakukan penelitian, pengembangan dan bahkan menghasilkan produk cabe transgenik. Berdasarkan data dari Amir Husin (2004, cit Subagiono (2002)) terkait hasil penelitian dari lembaga-lembaga penelitian dibawah Badan Penelitian Pengembangan Pertanian dan Pusat Penelitian Pengembangan Bioteknologi LIPI serta Pusat Penelitian Antar Universitas di IPB Bogor, ternyata penelitian cabe secara rekayasa genetik belum dilakukan. Tanaman yang baru sudah dihasilkan adalah jagung tahan hama wereng, Kacang tanah tahan peanut stripe virus, kakao tahan penggerek buah Bt, dan kedelai tahan penggerek polong. Padi tahan penggerek batang dan wereng coklat, pepaya tahan papaya ring spot virus, dan tebu tahan penggerek batang. Tembakau tahan tobacco mozaik virus dan ubi jalar tahan hama boleng.

Penelitian cabai transgenik baru diketahui berdasarkan laporan Mulya et al (2005) bahwa laboratorium Virologi IPB telah mengadakan serangkaian penelitian untuk mendapatkan tanaman cabai yang tahan virus melalui pemulian tanaman dan rekayasa genetika. Untuk diketahui, virus-virus yang sering menginfeksi tanaman cabai adalah  virus mozaik ketimun (CMV), virus etch tembakau (TEV), virus mozaik tembakau (TMV), virus Y kentang (PVY), dan Chili veinal mottle virus (CVMV). CMV tanaman cabai (Capsicum annuum) dengan tanda-tanda terjadinya bercak-bercak (mozaik) pada daun. Akibatnya buah cabai gagal diproduksi sehingga terjadi reduksi hasil panen.

Penulisan makalah ini mencoba menelaah dan membandingkan tingkat perkembangan penelitian cabai transgenik Indonesia dan beberapa negara maju di dunia sehingga diharapkan mampu meningkatkan motivasi bangsa ini untuk mengejar ketertinggalan dari sisi IPTEK dengan bangsa lain..

1.2. Rumusan Masalah

Beranjak dari latar belakang diatas maka penulisan makalah ini akan membahas permasalahan berikut ini :

  1. Sejauh manakah tingkat perkembangan penelitian cabai transgenik di Indonesia ?
  2. Sejauh manakah perkembangan transgenik yang telah dilakukan negara-negara maju di dunia ?

1.3. Tujuan

  1. Mengetahui tingkat perkembangan penelitian cabai transgenik Indonesia
  2. Mengetahui tingkat perkembangan penelitian cabai transgenik negara-negara maju di dunia

BAB II. PERKEMBANGAN PENELITIAN

CABAI TRANSGENIK INDONESIA

2.1. Cikal Bakal Dimulainya Penelitian Cabai Transgenik

Penelitian cabai transgenik di Indonesia masih sangat jarang dilakukan oleh lembaga-lembaga peneliti ataupun instansi pendidikan. Hingga tahun 2004, laporan Amir Husin (2004, cit Subagiono (2002)) menyatakan bahwa lembaga-lembaga penelitian nasional seperti Badan Penelitian Pengembangan Pertanian dan Pusat Penelitian Pengembangan Bioteknologi LIPI serta Pusat Penelitian Antar Universitas di IPB Bogor belum menghasilkan produk penelitian cabai transgenik.  Penelitian ini baru diketahui setelah laporan penelitian Mulya (2005) menyatakan laboratorium virologi Institut Pertanian Bogor (IPB) telah melakukan serangkaian penelitian untuk mendapatkan tanaman cabai yang tahan virus dengan pendekatan pemulian tanaman dan rekayasa genetika.  Selain cabai transgenik tahan virus, Yus (2008) juga sudah mulai melakukan penelitian cabai transgenik yang tahan terhadap cekaman biotik dan abiotik dengan gen P5CS

Menurut Mulya (2005), untuk mendapatkan tanaman cabai transgenik tahan virus ada tiga kunci yang harus dilakukan yaitu:

1).  Tersedianya gen antivirus (gen CP CMV)

2). Tersedianya cara introduksi gen CP ke dalam genom tanaman cabai dan regenerasi cabai transgeniknya

3). Ekspresi gen CP pada tanaman transforman

Jika salah satu dari tiga komponen tersebut tidak ada maka akan sangat sulit melakukan penelitian menghasilkan tanaman cabai transgenik. Komponen poin 1 dan 2 sudah tersedia berkat hasil penelitian oleh Siregar dan Sudarsono pada tahun 1997.

Mulya (2005) dalam penelitian lainnya menyatakan bahwa tanaman cabai transgenik yang tahan virus PVY (CP PVY) telah diperoleh dan diuji ketahanannya. Begitupula dengan sejumlah varietas dan galur tanaman cabai yang mempunyai ketahanan alamiah (natural resistant) dengan berbagai karakter agronomis juga sudah diuji dan diperoleh untuk dikoleksi. Adapun virus CMV merupakan virus yang komplek menimbulkan dampak terhadap tanaman cabai.

2.2. Penelitian Edy Batara Mulya Siregar dengan judul “ Kontruksi Gen Cp CMV pada Agrobacterium” (2005).

Untuk menyediakan tanaman cabe transgenik yang tahan terhadap CMV, Edy Batara melakukan beberapa tahapan penelitian yang menjadi tujuan dasar dilaksanakan penelitian ini, yaitu: 1. menyedian gen anti virus CMV (CP CMV)

2. menghasilkan vektor transforman yang mengandung gen CP CMV

3. menghasilkan planlet tanaman cabe transgenik yang mengandung gen CP CMV

Dalam menyediakan gen anti virus CMV, Edy Batara terlebih dahulu melakukan tahapan-tahapan sebagai berikut secara ringkas :

a. Disain primer oligonukleotida gen CP CMV

Disain ini membutuhkan 20 pasang basa yang dirancang berdasarkan hasil publikasi ( Namba et al, 1991).

Tabel 1. Primer spesifik yang digunakan untuk mengamplifikasi CP CMV menurut Namba et al (1991).

Primer Urutan Nukleotida
Primer F 5’ AGCTAACCATGGACAAATCTGGATGTCCCAAT 3’
Primer R 5’ AGCAATCCATGGGGCAGTTTGAAGCAATACTACC 3’

b. Ekstraksi RNA total dari sampel tanaman

Pengambilan sampel CMV adalah dari sampel tanaman tembakau yang terinfeksi CMV. Diambil sebanyak 0,1 g digerus dalam 600 µl larutan (3 ml STE 2x, 0,03 g SDS dan 30 µl  mercaptoethanol  sampai hancur dan larut. Larutan SAP yang diperoleh disentrifugasi pada 12 000 rpm pada suhu 4’ C selama 5 menit. Supernatan diambil 200 µl dan ditambahkan 200 µl PCI, divorteks sampai homogen dan kemudian di sentrifugasi  12 000 rpm selama 5 menit (diulang selama 2 x). supernatan sebanyak 200 µl dan ditambahkan 200 µl chloroform, divorteks sampai homogen dan kemudian disentrifugasi pada 12 000 rpm selama 5 menit (diulang selama 2x). Supernatan yang diperoleh ditambah 0,1 volume supernatan dengan 3 M NaOc dan 3 x volume supernatan  dengan larutan ethanol 99 % dingin. Setelah dibolak-balik suspensi disimpan pada-20’C selama 2 jam. Selanjutnya disentrifugasi 12 000 rpm selama 5 menit pada suhu 4’C. Pelet yang diperoleh dicuci dengan 150 µl ethanol 70% dingin, kemudian disentrifugasi  12 000 rpm selama 5 menit pada suhu 4’C. Ethanol diambil secara perlahan-lahan dan divakum sampai kering selama 20 menit, kemudian ditambahkan 10µl aquabidest.Setelah divorteks sampai larut, suspensi RNA dipindahkan ke PCR tube dan siap digunakan untuk RT-PCR atau disimpan pada suhu -20’C.

c. Proses RT-PCR CP CMV

Proses reverse transcription polymerase chain reaction ) atau reaksi transkripsi balik yang dilakukan menurut Bohringer Mannheim RT-PCR kit.

d. Kloning dan konstruksi gen CP CMV pada plasmid vektor

Kloning bertujuan untuk memperoleh klon bakteri yang mengandung plasmid recombinan antara cDNA CP CMV dengan  plasmid vektor. Awal kloning  cDNA CP CMV dilakukan dengan meligasikannya pada plasmid vektor. Plasmid vektor yang digunakan adalah pGEM-T Easy berukuran 3018 bp (promega) yang mempunyai kelebihan nukleotida T (T-overhang) pada kedua ujung situs kloning.

e. Transformasi plasmid rekombinan

Transformasi plasmid recombinan dilakukan ke dalam Eschericia coli DH5a yang kompeten (Max eficiency). Prosedur transformasi adalah; 2 µl larutan hasil ligasi ditambahkan 50 µl sel E.coli yang kompeten dan diinkubasikan selama 20 menit dalam es, perlakuan panas (heat shock) selama 50 detik pada suhu 42’C dan segera dikembalikan ke dalam es selama 2 menit. Kemudian ditambahkan 950 µl media SOC dan diinkubasi selama 1,5 jam pada suhu 37 ‘ C sambil digoyang dengan kecepatan 200 rpm. Sebanyak 100 ml dari kultur cair bakteri tersebut dikulturkan pada media seleksi LB yang mengandung ampisilin dan X-gal, serta diinkubasikan selama 12 jam pada suhu 37 ‘C

f. seleksi klon positif

Klon positif (koloni bakteri berwarna putih) diseleksi menggunakan teknik (Thomson & Dietzgen, 1997).Satu koloni diambil dengan tusuk gigi steril dan diresuspensikan ke dalam 1 µl air steril. Reaksi campuran kosentrasi akhir mengandung 0,2 mM dNTP, 1.5 unit tag polymerase, 1 µl reverse dan forward primer, dan akuabidest ditambahkan sehingga volume akhir 24 µl. Reaksi PCR dilakukan pada mesin PCR Perkin Elmer 4800 dengan siklus 94’C selama 1 menit, 25 siklus 94’C selama 10 detik, 50 ‘C selama 20  detik, dan 72 ‘C selama 60 detik sebelum didinginkan sampai 15 ‘ C. Produk amplifikasi dideteksi dengan elektroforesis gel agarosa untuk melihat adanya insersi dalam ukuran DNA.

g. Konstruksi vektor transformasi

DNA CP CMVdiinsersikan ke dalam plasmid pCAMBIA 1301 yang mengandung promoter kuat 35 S untuk tanaman. Vektor biner akan dibuat dengan mengikuti metode yang dijelaskan oleh Hoekema et al (1983) dan Bevan (1984). Plasmid  pCAMBIA 1301 yang mengandung gen CP CMV yang dimobilisasikan A. tumefeciens strain EHA101 dan EHA 105 dengan system try parental mating dengan menggunakan bantuan bakteri penolong HB101(pRK2013). Selanjutnya bakteri diseleksi dengan menggunakan antibiotik penyeleksi.     

2.3. Penelitian Edy Batara Mulya Siregar dan Emmy Harso Kardinata dengan judul “ Rekayasa Genetika Tanaman Cabai (Capsicum annuum L) Tahan Virus Mozaik Ketimun (CMV)” (2005)

Ada tiga tujuan khusus penelitian yang dilakukan oleh Edy Batara Mulya Siregar dan Emmi Harso Kardinata ini, yaitu;

1) menyediakan gen antivirus CMV (CP CMV).

2) menghasilkan vektor transforman yang mengandung gen CP CMV

3) menghasilkan planlet tanaman cabai yang mengandung gen CP CMV

Selain itu juga ada tiga aktifitas penting yang dilakukan pada penelitian tersebut yaitu; introduksi gen CP CMV ke dalam genom tanaman cabai, analisis molekuler tanaman transgenik, uji ketahanan tanaman transgenik serta mengetahui pola pewarisan gen CP CMV yang terdapat pada tanaman transgenik.

Aktifitas introduksi gen CP CMV meliputi persiapan kultur bakteri, kokultivasi, seleksi dan pemeliharaan kultur. Tiga kultivar cabai yang disediakan adalah Tit.L Super, Jatilaba dan Laris digunakan sebagai tanaman bahan percobaan. Daun dari kecambah cabai in vitro yang berumur 21 hari digunakan sebagai eksplan untuk di kokultivasi dengan kultur Agrobacterium dengan cara merendam eksplan di dalam suspensi bakteri selama lima menit. Kemudian eksplan dikulturkan pada media regenerasi, yaitu media dasar MS yang ditambahkan BAP (4 mg/l) dan IAA (0,25 mg/l), antibiotik penyeleksi (50 dan 100 mg/l sesuai perlakukuan). Jumlah antibiotik yang ditambahkan pada media merupakan bagian percobaan untuk mengetahui efisiensi transformasi. Selain itu pada media juga ditambahkan antibiotik cefotaxime (500 mg/l) untuk membunuh Agrobacterium. Eksplan disubkultur pada media seleksi yang masih segar setiap tujuh hari sekali. Semua kultur diinkubasikan dalam ruang kultur dengan intensitas penyinaran  1000 sampai 1500 lux selama 24 jam. Suhu ruangan diatur berkisar 26-28 ‘C. Pengamatan pada aktifitas tersebut adalah pada jumlah eksplan yang hidup, eksplan yang beregenerasi dan jumlah tunas yang terbentuk.

Adapun untuk aktifitas analisis molekuler tanaman transgenik, uji ketahanan tanaman transgenik serta mengetahui pola pewarisan gen CP CMV tidak dipublikasikan oleh Edy Batara Mulya Siregar dan Emmi Harso Kardinata. Laporan akhir penelitian mereka menyebutkan masih menunggu tunas tanaman membesar dan lengkap sehingga baru bisa dilakukan analisis molekuler.

Hasil dari Aktifitas penelitian pada tahap introduksi gen CP CMV ke dalam genom tanaman cabai belum memperlihatkan hasil yang maksimal. Hasil pengamatan baru mengetahui  pengaruh  tingkat populasi bakteri pada jumlah OD600=0,2 dan OD600=0,5. Waktu inokulasi 2,5 dan 5 menit; waktu kokultivasi 0, 1 dan 2 hari; dan pengaruh prekultur (1, 2 dan 3 hari) sebelum eksplan di kokultivasi. Respon eksplan justru memperlihatkan daya hidup yang sangat rendah. Hanya saja, belum dipublikasikan produk planlet yang diharapkan.

BAB III. PERKEMBANGAN PENELITIAN

CABAI TRANSGENIK DI DUNIA

Penelitian terkait cabe transgenik sudah cukup banyak dilakukan para ahli bioteknologi tanaman di dunia. Beberapa penelitian yang dilakukan diantaranya adalah :

3.1. S. J. Kim , S. J. Lee , B.-D. Kim dan K.-H. Paek dengan judul penelitian “ Satellite-RNA-mediated resistance to cucumber mosaic virus in transgenic plants of hot pepper (Capsicum annuum cv. Golden Tower)” (Plant cell report/1997)

S. J. Kim · S. J. Lee · B.-D. Kim (Department of Horticulture, Seoul National University, K.-H. Paek (Graduate School of Biotechnology, Korea University, Seoul ). Present address: Department of Vegetable Crop, University of California, Davis,  USA

Tahapan-tahapan metoda penelitiannya adalah:

1. Penyediaan bahan tanaman dan virus

Tipe strain dari CMV –Y dan CMV- Kor disiapkan yang diperoleh dari Dr Eun Kyung Park dan Lembaga Penelitian Tembakau. Virus CMV dipertahankan sebagai partikel untuk dimurnikan pada -70 ° C. Tanaman  Capsicum annuum T1 disiapkan yang diperoleh dari hasil polinasi tanaman T0 yang digunakan dalam penelitian ini. Chenopodium amaranticolor adalah digunakan sebagai host lokal untuk dua strain CMV.

2.Seleksi dengan menggunakan kanamycin

Dua tanaman transgenik To bebas yang memproduksi RNA satelit CMV , kemudian dibuahi sendiri untuk menghasilkan biji tanaman T1. Setelah itu dilakukan analisis segregasi progeni dengan kosentrasi kanamycin yang berbeda-beda terhadap kecambah biji T1 dalam medium MS. Penambahan kosentrasi kanamysin adalah 50, 100, 150, 200 dan 250 mg/l kanamycin sulfate.   Dipilih kosentrasi 200 mg/l untuk segregasi analisis progeni dan diambil anakan yang tahan terhadap seleksi kanamycin yang didapatkan setelah  6 minggu setelah germinasi (setelah terbentuknya sel-sel kelamin).

3. Lakukan Polymerase chain reaction (PCR)

Dua derivat oligonukleotida spesifik yang berasal dari gen neomycin phospo transferase II (npt II) digunakan sebagai bahan primer untuk analysis PCR. Satu nukleotida (5′-GAGGCTATTCGGCTATGACTG-3′) berlokasi pada posisi 201–221 dari gen npt II  dan lainnya (5′-ATCGGGAGCGGCGATACCGTA-3′) pada posisi 900–880 (Beck et al. 1982). Genom DNA dipersiapkan dan diamplifikasi oleh prosedur modifikasi oleh Edwards et al. (1991). Reaksi PCR dilakukan dalam 50 µl larutan yang mengandung 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 50 µg/ml BSA, 0.001% gelatin, 200 µM masing-masing dari dNTPs, 2 unit dari Taq DNA polymerase and 50 pmol setiap oligonucleotida primer. Reaksi PCR dilakukan pada thermal cycler (Perkin Elmer Cetus) dengan diawali dengan denaturasi selama 2 menit pada suhu 94°C dan kemudian 30 siklus selama 1 menit pada suhu 94 ° C, 1 menit pada 55 ° C, dan 2 menit pada suhu 72 ° C, diikuti dengan langkah akhir 7 menit pada 72 ° C. PCR products disimpan pada 4 ° C sebelum gel analisis.

4. Analisis blot gel RNA

Seluruh RNA diektraksi dari daun  tanaman T0 dan T1 pada determinasi ekspresi cDNA klon dari RNA Satelit CMV (Chomczynski and Sacchi 1987). Sampel RNA sebanyak 10 mg diujikan dengan folmaldehid dan formamide menurut Sambrook et al.
(1989). Sampel dielektroforesis pada 1,0 % gel agarosa yang mengandung 0,67 M formaldehid. Kemudian ditransfer pada suatu membran nylon. Membran itu dihibridisasi pada suhu 42 ° C selama 18 jam dalam 0,1 % SDS, 5 x solusi Denhardt’s, 5 × SSPE, dan dipotong sebanyak 100 mg / ml, didenaturasi dengan sperma DNA ikan haring yang mengandung 50 % formamide. Pemeriksaan terhadap DNA dilakukan oleh label sebuah fragmen SCAI 0.3-kb (Paek dan Hahn 1991) dengan [α-32P]dCTP menggunakan methoda priming random (Feinberg and Vogelstein 1983). Membran tersebut dicuci dengan agitasi konstan, dua kali pada 2 × SSPE ditambah 0.1% SDS selama 15 menit pada suhu 42°C, dan sekali pada 0.1× SSPE ditambah 0.1% SDS selama 10 menit pada suhu  52°C. Membran diekspos pada sinar X dengan satu layar intensif suhu –70°C.

5. Mekanisasi test inokulasi

Tanaman T1 diambil daunnya sebanyak tujuh hingga delapan untuk digunakan dalam test inokulasi virus. CMV-Y dan CMV-Kor- yang sebelumnya didemonstrasikan tidak memiliki satelit RNA (Kim et al. 1995) digunakan pada inokulasi tanaman non transformasi dan transgenik. Dua atau tiga daun dari tanaman nontransformasi dan transgenik mengekspresikan RNA satelit. Kemudian ditaburi carborundum (500 mesh)

Dan mekanisasi inokulasi dengan CMV-Y or CMV-Kor pada kosentrasi 10 µg/ml dalam 0.01 M sodium phosphate buffer, pH 7.2. Setelah diinokulasi, permukaan daun dibilas dengan air keran, ditumbuhkan pada rumah kaca pada suhu 22-30 ° C. Gejala perkembangan dimonitor setiap hari selama kurang lebih 2 bulan setelah diinokulasi. CMV-Kor menghasilkan khas mosaik dan daun-keriting, sementara  CMV-Y biasanya menghasilkan mosaik kuning parah dan klorosis pada cabe. Untuk melihat kuantifikasi dan konfirmasi gejala attenuasi (kekurangan), dilakukan test lokal pada tanaman Capsicum amaranticolor

3.2. Gyulai G, J.A. Gemesne, Zs. Sagi, L. Zatyko, L. Heszky, G. Venczel dengan judul penelitian PCR-ANALYSIS OF F1 HYBRID DERIVED DH PEPPER LINES ” (1999). *Department of Genetics and Plant Breeding, Agricultural University, Godollo, H-2103. **Vegetable Crops Research Institute, Budapest, Hungary.

Metoda Penelitiannya adalah

Kultur antera. F1 hibrida dari hasil persilangan intercultivar sebagai tanaman antera donor ditanam di rumah kaca. Tunas bunga dikumpulkan pada tahap mikrospora uni nukleat. Kumpulan kepala sari ( 15 anthera per petridish, 6 cm) dipotong dan diletakkan pada suatu media nutrisi Dumas Vaulx de et (1981), ditambah dengan 0,01 mg/l 2 ,4 dichlorophenoxyacetic acid (2,4-D) dan kinetin masing-masingnya. Sumber gula dan kosentrasi dirubah sesuai dengan modifikasi Gemesne Juhasz et al. (1998). Larutan Kultur diinkubasi selama 8 hari pada 35 ° C pada dar 1 <., Kemudian dipindahkan ke suhu 25 ° C dengan satu fotoperiode 12 h.

Antera ditransplantasi ke dalam 2,4-D-tanaman bebas dengan medium regenerasi yang ditambah dengan 0.1mg /l kinetin (Dumas de Vaulx et al 1981.). Planlet dikembangkan dari embrio yang berakar pada medium honnone-bebas. Regenerasi (R,) tanaman dipotkan. Dan ditanam di rumah kaca untuk aliran cytometry, atau R2 – produksi benih.

Penggandaan kromosom. digunakan untuk pengembangan induksi dihaploid, tunas aksiler dari regeneran haploid dibuang dan 1% w/w colchicine dimasukan pada materi gelling (untuk analisa lebih lanjut).

Aliran Cytometry. Detenninasi dari tingkatan ploidi dilakukan oleh PARTEC Ploidi Analyser. PA-I (Partec Munster, 1 Gennany) dilengkapi dengan lampu dengan tekanan tinggi (Osram HBO-100W / 2) sesuai dengan metode I Dolezel et al (1989) sebelum persiapan sampel. DH-R, selembar daun dicincang dan 1 dimaserasi di LBO1 (1 ml) digunakan untuk analisis buffer agar melepaskan huclei utuh. Supenatan itu disaring melalui suatu CeilTrics dari jenis penyaring nylon dengan ukuran pori-porinya 30 untuk memisahkan sisa-sisa sel. Inti sel diberi label 4′, S’-diamino-2-phenylidole, 14 I J.M, (DAPI, Sigma) berisi larutan buffer LBO1 (1ml). Masing-masing sampel direplikasi dalam tiga ulangan dibandingkan dengan kontrol tanaman (Ro) diploid sebelum penghitungan kromosom (2n =24) pada ujung akar saat persiapan acetocannine .

PCR Study.

– DNA Isolasi. Biji DH-R1 dikecambahkan pada petridish untuk dianalisis molekulnya. Kumpulan genom sampel DNA diekstraksi dari beberapa individu dari sembilan tanaman DH-R1, dan satu kontrol R0 tanaman sebagai donor anthera masing-masing.

Anakan-anakan subjek daun diremas (Ravenel Spec. Inc,) dengan menggunakan 750 IJ.I yang terdapat pada larutan buffer CTAB, diikuti dengan menggunakan metode Dweikat et al (1994),memanfaatkan modifikasi Gyulai et al (1997). Sampel DNA diperlakukan dengan menggunakan enzim RNase, 5I, selama 30 menit pada suhu 37 ‘ C.

– Analisis PCR. Reaksi amplifikasi dijalankan pada volume 25 ~ I oleh CoyTempCyder, 110 SM.  Campuran reaksi berisi 15,625 ~ M masing-masing mengandung deoxynucleotide; 0,05 mM MgCI2: 1,5 U Taq-polimerase (baik menurut Sigma, Promega, atau WestTeam); 24 pM primer (baik menurut SSSR / ISSR atau RAPD / operon Technologies), 2,5 ~ I dari 10 x buffer thermophylic; dan 20 DNA template ~ g. Cairan DNA diukur  sebelumnya dengan spektrofotometer UV-(Jenway 6105) pada OD260 nm.

– PCR-primer. Primer berikut diterapkan, OP / A 1-20 untuk analisis RAPD; (ACTG) 4 dan (GACA) 4 untuk analisis SSR dan CA (GACA) 4, AC (GACA) 4, (GACA) ~ C, (GACA) 4CA untuk analisis ISSR. Campuran reaksi dilapisi dengan setetes minyak mineral (Sigma).

Untuk amplifikasi PCR, 40 cydes dijalankan dengan langkah-langkah berikut:

(1) 20 detik pada 94 ° C untuk denaturasi DNA sebelum suatu pemanasan sampel  pada 84 ° C selama 5 menit,

(2) 20 detik pada 40 ° C untuk anil primer,

(3) 90 menit pada 72 ° C selama reaksi polimerase DNA,

(4) ekstensi akhir pada suhu 72 ° C selama 5 menit, dan terakhir merendam pada 4 ° C sampai sampel dibongkar.

Minimum dipersiapkan tiga DNA independen setiap baris yang digunakan. Masing-masing reaksi sukses dengan pita sc,:>rable yang diulangi setidaknya dua kali. Amplifikasi diuji dengan agarose (1,8%, SeaKem LE, FMC) gel elektroforesis (Owl sistem), diwarnai dengan bromida (1 ~ g / ~ I) di 80 V dalam 1 buffer TAE X dan difoto pada iluminator Tran UV (Pharmacia) oleh kamera Polaroid.

– Fragmen analisis. Ketajaman fragmen PCR diberi skor untuk kehadiran versus absen dari profil. Fragmen PCR dengan intensitas yang rendah hanya memberi skor sebagai kehadiran ketika mereka direproduksi dalam eksperimen ulangan. Suatu pengendalian negatif yang berisi semua komponen PCR diperlukan kecuali template DNA termasuk dalam running PCR.

BAB IV. KESIMPULAN

Penelitian cabe transgenik di Indonesia masih belum begitu berkembang. Sejak tahun 2005 hanya sedikit para ahli yang telah mempublikasikan penelitiannya terkait cabe transgenik ini. Di Indonesia masih terfokus dalam pembuatan gen anti CMV atau CP CMV . Tanaman transgenik belum terpublikasi keberhasilannya di lapangan. Berbeda dengan penelitian dari para pakar di negara maju yang sudah berhasil melihat ketahanan tanaman transgeniknya. Dari sisi kompleksitas peralatan dan methodanya, penelitian yang dilakukan para pakar di negara maju lebih komplek dibandingkan penelitian lokal Indonesia. Namun, ada sedikit kesamaan bahwa Indonesia sudah menggunakan PCR dalam proses penelitian tanaman cabe transgeniknya walaupun dari sisi kinerja lebih sederhana dibandingkan dunia.

DAFTAR PUSTAKA

Batara, Edy. 2005. Kontruksi Gen Cp CMV pada Agrobacterium. Jurusan Kehutanan Fakultas Pertanian Universitas Sumatera Utara : Medan

Batara, Edy. Dkk. 2005 Rekayasa Genetika Tanaman Cabai (Capsicum annuum L) Tahan Virus Mozaik Ketimun (CMV). Laboratorium Bioteknologi Fakultas Pertanian Universitas Sumatera Utara. Medan

Kim, SJ. Dkk.1997. Satellite-RNA-mediated resistance to cucumber mosaic virus in transgenic plants of hot pepper (Capsicum annuum cv. Golden Tower)”. Department of Vegetable Crop, University of California, Davis,  USA

G, Gyulai.dkk. 1999. PCR-ANALYSIS OF F1 HYBRID DERIVED DH PEPPER LINES).  Vegetable Crops Research Institute, Budapest, Hungary.

Dipublikasi di Uncategorized | Meninggalkan komentar

Perbandingan Kemajuan Bioteknologi negara maju dengan Indonesia

BAB I. PENDAHULUAN
1.1. Latar Belakang
Bioteknologi (biotek) merupakan salah satu cabang ilmu biologi yang mempelajari tentang pemanfaatan makhluk hidup menghasilkan barang atau jasa untuk kepentingan hidup manusia. Makhluk hidup yang dimanfaatkan dapat berupa makhluk hidup secara utuh atau bagian dari makhluk hidup, seperti sel, jaringan, dan enzim.
Sebenarnya, prinsip dasar bioteknologi telah diterapkan sejak ribuan tahun yang lalu. Hanya saja, pada masa itu para leluhur manusia tidak mengenalnya sebagai bioteknologi. Istilah bioteknologi ini baru populer muncul sekitar tahun 1970-an, yaitu setelah para ilmuwan berhasil melakukan rekayasa genetika. Sejak tahun tersebut hingga sekarang istilah bioteknologi semakin popular yang diikuti dengan munculnya berbagai produk penemuan di bidang bioteknologi ini. Produk-produk tersebut berkembang pada semua bidang, seperti; pertanian, makanan, industri, kesehatan dan sebagainya.
Dari sekian banyak produk bioteknologi, para ahli sudah mengelompokan dengan dasar yang beragam. Wikipedia (2010), mengelompokannya atas bioteknologi putih (industri dan energi), bioteknologi merah (kesehatan), bioteknologi hijau (pertanian dan peternakan) dan bioteknologi biru (perairan). Ada juga yang mengelompokan melalui sejarahnya. Bioteknologi generasi pertama, generasi kedua, generasi ketiga dan generasi baru (Defri,2009). Namun pengelompokan yang umum digunakan adalah berdasarkan perkembangan proses dan peralatan yang digunakan. Sebagian dimasukan ke dalam bioteknologi konvensional dan sebagian lainnya dimasukan ke dalam bioteknologi modern.
Prinsip bioteknologi konvensional adalah melakukan praktik bioteknologi dengan cara dan peralatan yang sederhana, memanfaatkan organiseme secara utuh, dan didapatkan melalui pengalaman yang diturun-temurunkan. Adapun bioteknologi modern lebih banyak menerapkan prinsip rekayasa genetika dengan peralatan modern. Organisme hanya dilibatkan sebagian dari anggota tubuhnya atau produknya saja. Selain itu, proses penerapan membutuhkan pengetahun khusus yang didapatan melalui proses akademisi.
Bioteknologi tanaman merupakan salah satu penerapan prinsip-prinsip bioteknologi dseperti iatas pada suatu tanaman dengan tujuan untuk meningkatkan produksi dan kualitas dari tanaman. Bioteknologi tanaman ini ada yang bersifat konvensional (tradisional) ataupun yang bersifat rekayasa genetika (modern).
Perkembangan bioteknologi tanaman telah melahirkan banyak produk yang bermanfaat bagi manusia. Perkembangan tersebut juga berbeda pada setiap negara. Negara Indonesia dengan negara-negara maju di dunia memiliki perbedaan tingkat pengetahuan dan teknologi sehingga menyebabkan perkembangan bioteknologi tanamannya juga berbeda. Oleh karena itu, penulisan makalah ilmiah ini berupaya untuk mengungkapkan sejarah dan perkembangan bioteknologi tanaman Indonesia dengan membandingkan perkembangan di beberapa negara maju di dunia, seperti; Amerika, Eropa dan China (Asia).

1.2. Rumusan Masalah
Beranjak dari latar belakang diatas maka penulisan makalah ilmiah akan membahas :
1. Bagaimanakah sejarah dan perkembangan bioteknologi tanaman negara maju dan Indonesia
2. Apa saja produk-produk bioteknologi tanaman yang terdapat di Indonesia dan beberapa negara maju di dunia ?
3. Apa saja faktor penting yang akan mempengaruhi kemajuan bioteknologi tanaman di Indonesia.

1.3. Tujuan Penulisan
1. Memenuhi tugas mata kuliah Bioteknologi pada program Pasca Sarjana Biologi Universitas Andalas Padang.
2. Mengetahui sejarah dan perkembangan bioteknologi tanaman negara maju dan Indonesia.
3. Mengetahui produk-produk bioteknologi tanaman yang terdapat di Indonesia dan beberapa negara maju di dunia
4. Mengetahui apa saja faktor penting yang akan mempengaruhi kemajuan bioteknologi tanaman Indonesia.
BAB II. SEJARAH DAN PERKEMBANGAN
BIOTEKNOLOGI TANAMAN NEGARA MAJU DAN INDONESIA

2.1 . Sejarah Bioteknologi Tanaman

Bioteknologi adalah cabang ilmu biologi yang mempelajari tentang pemanfaatan makhluk hidup (meliputi bakteri, fungi, virus, dan lain-lain) maupun produk dari makhluk hidup tersebut (meliputi enzim, alkohol, dan sebagainya) dalam proses produksi menghasilkan barang dan jasa untuk kepentingan manusia ( Evi, 2009). Jika pengertian bioteknologi tersebut dikontekskan pada tanaman maka pengertiannya adalah pemanfaatan tanaman ataupun produk dari tanaman dalam proses produksi menghasilkan barang dan jasa untuk kepentingan manusia.
Sebenarnya, kemunculan bioteknologi (biotek) tanaman tidak terlepas dari sejarah biotek itu sendiri yang sudah diterapkan sejak ribuan tahun yang lalu. Walaupun istilah bioteknologi baru populer muncul tahun 1970-an pasca penemuan teknik rekayasa genetika namun prinsip bioteknologi sudah dikembangkan sejak lama. Pada tahun 8000 SM, Bangsa Babylonia, Mesir dan Romawi sudah melakukan pengumpulan benih dan penyeleksiannya untuk meningkatkan kualitas pertanian dan ternak. (Diah, 2007).
Perkembangan biotek tanaman juga tidak terlepas dari keaktifan para ahli generasi awal untuk melakukan pengumpulan berbagai jenis tanaman sejak tahun 1500 M. Penemuan sel tahun 1665 M oleh Robert Hooke dengan menggunakan mikroskop telah semakin meningkatkan motivasi para ahli mengembangkan pengetahuan tentang makhluk hidup, salah satunya tumbuhan. Martias Schleiden memperkaya pengetahuan tentang sel tumbuhan dengan organel-organel yang terdapat di dalamnya. Mikroorganisme pun mulai ditemukan pada tahun 1880 M. Gregor Johan Mendel (1856) pada akhirnya berhasil menemukan prinsip-prinsip hibridisasi (persilangan) pada tanaman kacang ercis (Pisum sativum) yang merupakan salah satu produk bioteknologi tanaman . Tahun 1865, dia menyempurnakan penemuannya melalui prinsip-prinsip pewarisan sifat (Diah, 2007).
Para ahli menganggap bahwa bioteknologi tanaman yang tertua yang masih berkembang sampai saat ini adalah teknik budidaya pertanian. Kegiatan pertanian merupakan salah satu bentuk pengembangan prinsip bioteknologi tanaman dengan memanfaatkan organisme yang secara total.
Sejak zaman awal peradaban manusia, kegiatan pertanian sudah berlangsung. Para ahli prasejarah sepakat bahwa pertanian pertama kali berkembang di Timur Tengah sekitar 12.000 tahun yang lalu, meliputi daerah lembah Sungai Tigris dan Eufrat memanjang ke arah barat hingga daerah Suriah dan Yordania. Buktinya adalah bekas-bekas peninggalan budidaya tanaman biji-bijan (serealia, terutama gandum) dan polong-polongan. Pada saat itu, 2000 tahun setelah berakhirnya Zaman Es di era Pleistosen, daerah ini banyak dijumpai hutan dan padang yang sangat cocok bagi untuk dimulainya pertanian. Pertanian semakian dikenal setelah mencapai kebudayaan batu muda (neolitikum), perunggu dan megalitikum. Pertanian mengubah bentuk-bentuk kepercayaan, dari pemujaan terhadap dewa-dewa perburuan menjadi pemujaan terhadap dewa-dewa perlambang kesuburan dan ketersediaan pangan. (Wikipedia, 2010)
Teknik budidaya tanaman lalu meluas ke barat (Eropa dan Afrika Utara) yang saat itu Sahara belum sepenuhnya menjadi gurun) dan ke timur (hingga Asia timur dan Asia Tenggara). Bukti-bukti di Tiongkok menunjukkan adanya budidaya jewawut (millet) dan padi sejak 6000 tahun sebelum Masehi. Masyarakat Asia Tenggara telah mengenal budidaya padi sawah paling tidak pada saat tahun 3000 SM dan Jepang serta Korea sejak 1000 tahun SM. Sementara itu, masyarakat benua Amerika mengembangkan tanaman dan hewan budidaya yang sejak awal sama sekali berbeda. Budidaya sayur-sayuran dan buah-buahan juga sudah dikenal manusia sejak lama. Masyarakat Mesir Kuno (4000 tahun SM) dan Yunani Kuno (3000 tahun SM) telah mengenal baik budidaya anggur dan zaitun. (Wikipedia, 2010).
Meskipun prinsip-prinsip bioteknologi tanaman sudah berlangsung lama namun pemakaian istilah bioteknologi belum muncul pada masa itu. Pengenalan istilan bioteknologi, baru diperkenalkan pada tahun1919 M oleh Karl Ereky, seorang Insiyur asal Hongaria (Diaz, 2007). Istilah ini semakin populer pasca penemuan teknik rekayasa genetika pada tahun 1970-an. (Priadi, 2009)
2.2. Perkembangan Biotenologi Tanaman Di Negara Maju
Pada tahun 1992 dianggap sebagai awal revolusi bioteknologi di dunia. Produk-produk bioteknologi pangan, pertanian, industri, medis dan sebagainya semakin banyak bermunculan. Di bidang pertanian, tanaman transgenik yang merupakan produk rekayasa genetika menjadi sesuatu hal yang tak asing lagi hingga sekarang.
Menurut Fred Gale et al ( 2003), ada empat negara yang memiliki rangking tertinggi dalam memajukan bioteknologi tanaman. Negara tersebut secara berturut-turut adalah Amerika Serikat (USA), Canada, Argentina dan China. Posisi Eropa disini dianggap masih rendah dibandingkan empat negara tersebut. Eropa lebih mengunggulkan bioteknologi industri dan kesehatan dibandingkan tanaman. Dalam konteks Eropa, tingkat kemajuan bioteknologi tanaman bukan didominasi oleh negara-negara maju seperti Inggris, Prancis dan Jerman tapi justru didominasi peningkatan dari negara-negara yang tergabung dalam kelompok Nordik (Denmark, Finlandia dan Swedia) (Reis et al, 2004).
Hasil penelitian EPOHITE, pada tahun 1995 hingga 2000 negara-negara anggota bioteknologi eropa (15 negara) mengalami pertumbuhan luar biasa dalam perkembangan penelitian tentang biotek lingkungan dan biotek industri. Pertumbuhan yang signifikan terjadi pada produk pabrik sel. Negara Inggris dan Jerman dianggap negara yang paling banyak memiliki perusahaan yang berkecimpung di dalam bioteknologi tersebut. Namun ada sesuatu yang hilang dalam perkembangan bioteknologi di beberapa negara anggota bioteknologi Eropa yaitu; pengembangan bioteknologi tanaman. (Reis et al, 2004).
Perkembangan biotek tanaman lebih banyak dilakukan melalui produk teknologi rekayasa genetika, kultur jaringan dan DNA rekombinan untuk menghasilkan tanaman yang memiliki sifat dan produk unggul dengan zat gizi yang lebih. Produk tersebut dikenal dengan istilah produk transgenik. Produk ini dalam perkembangannya masih mendapatkan kecaman akibat memunculkan organisme baru di alam. Beberapa produk-produk transgenik yang sudah dihasilkan dari proses rekayasa genetika adalah :
1. Jagung resisten hama serangga
2. Kapas resisten hama serangga
3. Pepaya resisten virus
4. Enzim pemacu produksi susu pada sapi
5. Padi mengandung vitamin A
6. Pisang mengandung vaksin hepatitis
Perkembangan biotek tanaman tidak hanya berimplikasi positif tapi sisi negatif munculnya berbagai kekuatiran mengkonsumsi tanaman transgenik yang dianggap membahayakan kesehatan dan lingkungan. Mengatasi persoalan tersebut, organisasi Food and Drug Administration (FAD) yang didirikan di Amerika Serikat sebagai organisasi yang menyeleksi setiap produk-produk transgenik yang akan di pasarkan ke dunia. Pada tahun 1992 ini, FDA menyetujui produk makanan rekayasa genetika pertama kali yang aman untuk dikonsumsi yaitu; tomat “flavor saver” (Junaedi, 2010).
Bermunculannya produk-produk transgenik ke pasaran dunia sebagai produk ekspor negara-negara maju menjadikan FDA semakin meningkatkan pengawasannya. Pada tahun 2001, FDA membuat aturan baru yang lebih disiplin dan formalitas. Bagi perusahaan yang hendak memasarkan produk transgeniknya terlebih dahulu harus mengajukan ke FDA untuk diteliti dan diuji selama 120 hari sebelum di pasarkan. Serta perusahaan juga wajib menyertakan bukti bahwa produk yang dipasarkan tidak berbahaya atau tidak berbahaya dari produk sebelumnya. (Junaedi, 2010).
2.3. Masuknya Bioteknologi Tanaman Ke Indonesia
Wikipedia (2010) menyatakan bahwa budidaya pertanian yang merupakan salah satu produk biotek tanaman tertua sudah masuk sejak 3000 SM. Sedangkan menurut Balai Penelitian Perkebunan Indonesia (2009), bioteknologi tanaman mulai fokus dikembangkan di Indonesia pada masa Belanda melalui organisasi Lembaga Penelitian Perkebunan yang berkedudukan di Jalan Taman Kencana No. 1 Bogor, saat ini bernama Balai Penelitian Bioteknologi Perkebunan Indonesia.
Pada tahun 1901 sampai tahun 1916, di Pulau Jawa didirikan enam lembaga penelitian perkebunan, dua di antaranya berada di Bogor yaitu Algemeen Profestation voor Thee, Profestation voor Rubber. Gedung yang berdiri megah dengan model yang sangat spesifik di Jalan Taman Kencana No. 1 dibangun pada tahun 1926. Gedung tersebut merupakan tonggak sejarah kebesaran lembaga penelitian perkebunan di Pulau Jawa selama masa penjajahan Belanda. Pada tahun 1933 dilakukan penciutan dari enam menjadi tiga lembaga penelitian yaitu Profestation West Java, Profestation Midden-en Oost Java dan Besoekisch Profestation. Ketiganya semula dikelola oleh Algemeen Landbouw Syndicat (ALS) namun kemudian diserahkan kepada Centrale Vereniging tot Beheer van Profestation voor de Overjarige Cultuur in Indonesie yang lebih dikenal dengan sebutan Centrale Profestation Vereniging (CPV).(BPPI, 2019)
Dalam perjalanannya, Profestation West Java diubah menjadi Profestation der CPV Bogor, Profestation Midden-en Oost Java menjadi Profestaion der CPV Malang, dan Besoekisch Profestation menjadi Profestation der CPV Jember. Pada tahun 1952 ketiga lembaga penelitian tersebut di atas digabung menjadi satu yakni Profestation der CPV yang berkedudukan dan berpusat di Bogor, dengan Jember sebagai cabangnya.
Selanjutnya sehubungan dengan pengambil-alihan perusahaan-perusahaan milik Belanda oleh pemerintah Indonesia pada tahun 1957 maka Profestation der CPV diubah namanya menjadi Balai Penyelidikan Perkebunan Besar berkedudukan di Bogor dengan cabangnya di Jember. Bersamaan dengan itu Indonesisch Instituut voor Rubber Onderzoek/INIRO yang berkedudukan di Jalan Salak No. 1 Bogor (berdekatan dengan gedung CPV) diubah namanya menjadi Balai Penyelidikan dan Pemakaian Karet. Pada tahun 1968 kedua lembaga penelitian tersebut digabung dan namanya diganti menjadi Balai Penelitian Perkebunan Bogor.
Mulai tahun 1987 Balai Penelitian Perkebunan Bogor berada di bawah pengelolaan Asosiasi Penelitian dan Pengembangan Perkebunan Indonesia (AP3I). Pada tahun 1989 nama Balai Penelitian Perkebunan Bogor diubah menjadi Pusat Penelitian Perkebunan Bogor. Dalam upaya untuk melaksanakan penelitian bioteknologi perkebunan secara terpadu dan efisien, pada tahun 1993 Pusat Penelitian Perkebunan Bogor diubah menjadi Pusat Penelitian Bioteknologi Perkebunan. Dengan gedung, fasilitas, dan SDM yang masih sama, akhirnya, pada tahun 1996 lembaga penelitian yang sebelumnya pernah memiliki nama besar di Indonesia diubah menjadi Unit Penelitian Bioteknologi Perkebunan (UPBP), sebuah lembaga yang secara de jure hilang dari struktur organisasi resmi. Lalu pada tahun 2003 lembaga ini berganti nama menjadi Balai Penelitian Bioteknologi Perkebunan.
Program Bioteknologi tanaman juga sudah dimasukan ke dalam peraturan yang tetap pada masa presiden Soeharto. Menurut Swastika et al (2008) pada tahun 1983 sudah diterapkan juga agenda penting program bioteknologi nasional. Selain itu, GBHN tahun 1993 dalam Pelita VI, sasaran Bidang Pembangunan Ilmu Pengetahuan dan Teknologi menyatakan bioteknologi dimasukkan dalam Kebijaksanaan Nasional sebagai suatu bidang Iptek yang perlu dikembangkan. Beberapa produk biotek tanaman yang menjadi target pada masa ini adalah penciptaan tanaman baru yang dapat menghasilkan pupuk sendiri, tanaman yang tahan kekeringan, kebekuan, salinitas tinggi dan tekanan-tekanan lingkungan lainnya, substansi yang dapat mempercepat pertumbuhan ternak, vaksin untuk ternak, dan makanan ternak dengan harga yang lebih murah. (Pokatong, 2009).
Perkembangan biotek tanaman Indonesia memiliki prinsip pengawasan yang sama seperti yang terdapat di negara-negara maju dengan organisasi FDA. Walaupun perkembangan bioteknologi sedikit lambat namun setiap produk yang dihasilkan akan tetap melalui uji sebelum di pasarkan.
Di Indonesia, terdapat Badan Pengawas Obat-obatan dan Makanan (BPOM) memiliki fungsi yang sama dengan FDA di Amerika Serikat. Badan ini mengawasi kelayakan keamanan dari produk-produk makanan yang beredar di pasaran serta sebagai filter terhadap produk-produk baru yang masuk ke pasaran Indonesia. Peran Departemen Kesehatan juga ikut memperkuat posisi BPOM dengan pengeluaran izin terhadap suatu produk makanan. (Junaedi, 2010).
Kinerja BPOM ini tak terlepas juga dari pemberlakuan peraturan pemerintah melalui Surat Keputusan Bersama (SKB) Menteri Pertanian, Menteri Kehutanan dan Perkebunan, Menteri Kesehatan dan Menteri Ketahanan Pangan dan Hortikultura No.998.1/Kpts/OT.210/9/99;790a/Kpts-IX/1999;1145A/MENKES/SKB/IX/1999; 015A/ NmenegPHOR/09/1999 tentang Keamanan Hayati dan Keamanan Pangan Produk Pertanian Rekayasa Genetika (PPHRG/PRG). (Swastika, 2008)

BAB III. PRODUK BIOTENOLOGI TANAMAN
NEGARA MAJU DAN INDONESIA

3.1. Produk Bioteknologi Tanaman Negara Maju di dunia
Bioteknologi berdasarkan penggunaan peralatan dan tingkat pengetahuan yang dikembangkan terbagi atas dua yaitu bioteknologi konvensional dan bioteknologi modern. Dua tipe bioteknologi tersebut masih tetap berkembang hingga saat ini. Beberapa contoh bioteknologi konvensional adalah teknik hibridisasi (persilangan), teknik hidroponik, teknik aeroponik, dan sebagainya. Adapun biotek modern sangat berkembang di masa sekarang, terutama negara-negara maju.
Menurut Reis et al (2004), ada beberapa daftar dan produk bioteknologi yang sudah muncul dan berkembang pada negara-negara anggota biotek Eropa.
1. Daftar bioteknologi : biotek tanaman, biotek hewan, biotek lingkungan, biotek industri, biotek pabrik sel, pengembangan diagnostik manusia/hewan/sistem terapeutik, dan pengembangan biotek dasar
2. Produk Bioteknologi: Biocatalisis, biotek biokimia, biofiltrasi, bioproses, bioremediasi, budaya sel, fusi sel, kiral sentesis, teknik kloning, kimia kombinatorial, DNA probe, DNA sekuens, sintesis DNA/RNA, elektroforesis protein, elektroforesis DNA/RNA, protein sekuens, sintesis protein, fusi protoplast, pemurnian / pemisahan DNA / RNA, pemurnian / pemisahan biomolekul lainnya, pemurnian / pemisahan protein, teknologi enzim, teknologi fermentasi, genom fungsional, gen amplifikasi / PCR , terapi gen, genetic fingerprinting, high throughput screening, laboratorium robotika, marker teknologi (DNA, RNA), massa spektroskopi, metabolik rekayasa, mikromanipulasi, mikropropagasi, uji hewan model, molekul biotyping, pemodelan molekul, monoklonal antibodi, spektroskopi NMR, protein array, protein engineering, DNA rekombinan, hibridisasi somatik, genomik struktural, kultur jaringan, rekayasa jaringan dan xenotransplantation.
Adapun negara-negara yang tergabung ke dalam anggota bioteknologi Eropa adalah; Denmark, Swedia, Finlandia, Belanda, Inggris, Belgia, Jerman, Austria, Perancis, Irlandia, Italia, Spanyol, Portugal dan Yunani.
Dari sekian banyak produk bioteknologi modern dari negara-negara anggota biotek Eropa, teknik rekayasa genetika, kultur jaringan, dan DNA rekombinan sangat umum dilakukan untuk menghasilkan produk-produk transgenik yang merupakan salah satu produk bioteknologi modern. Jeleniae (2004) menyebutkan terdapat 70 varietas tanaman transgenik yang sudah disetujui untuk di pasarkan sejak dua dekade terakhir.
Papatryfon et al (2007) dalam analysis report tentang kebijakan Eropa dalam pengembangan bioteknologi modern menyatakan perkembangan bioteknologi tidak ada hanya pada industri obat-obatan, kertas, kesehatan dan makanan saja tapi juga dapat ditemukan pada sekolah-sekolah dasar produksi (pertanian, perikanan dan peternakan) dan tanaman pangan.
Negara China juga tak kalah bersaing dengan negara-negara anggota biotek Eropa. Dari sisi bioteknologi tanaman, negara ini termasuk empat negara besar yang memiliki kemajuan yang cukup tinggi. Sebagian produk ada yang sudah dipasarkan dan sebagian lain ada yang masih tahap menunggu izin pemasaran. (Gale et al, 2003)
Pada tahun 1999, China sudah mempunyai tanaman transgenik untuk kapas sebanyak 13 varietas, dua diantaranya sudah dipasarkan. Beras sebanyak 16 varietas. Gandum satu varietas, jagung, dua varietas, kedelai dua varietas, kentang dua varietas, dan Brassica napus dua varietas. Tembakau 4 varietas dan satu diantaranya sudah di pasarkan. Kacang satu varietas dan kubis satu varietas. Tomat 5 varietas, satu diantaranya sudah dipasarkan. Sweet pepper dua varietas, satu diantaranya sudah dipasarkan. Petunia dua varietas, satu diantaranya sudah dipasarkan. Dan tanaman lainya sebanyak 6 varietas.
(Gale et al cit Huang et al, 2003)
3.2. Produk-Produk Bioteknologi Indonesia.
Menurut Plantus cit Sutrisno (2010), jika dibandingkan perkembangan bioteknologi Indonesia dengan negara-negara maju, posisi Indoensia masih tertinggal dengan jarak dua gelombang. Negara-negara maju saat ini, bioteknologinya sudah masuk ke tahap gelombang ketiga dimana teknologi rekayasa genetika sudah ditujukan untuk memperkaya kandungan nutrisi tanaman. Sedangkan pada gelombang pertama, rekayasa genetik ditujukan agar tanaman tahan terhadap hama dan penyakit. Gelombang kedua untuk mengembangkan tanaman kesehatan. Posisi Indonesia baru dianggap pada gelombang kedua.
Bioteknologi Indonesia saat ini sedang mengembangkan padi yang tahan terhadap tanah masam dan mengandung alumunium tinggi. Sehingga padi tersebut sangat cocok di lahan-lahan marginal seperti lahan gambut. Teknik Marka molekuler (penanda molekuler) untuk menyeleksi sifat yang diinginkan dari keturunan hasil persilangan juga sudah dikembangkan. Metode ini melakukan pelacakan sifat-sifat tanaman berdasarkan DNA yang dimiliki tanaman.
Pada tanaman jagung marka molekuler digunakan untuk mengetahui jarak genetik (hubungan kekerabatan) jagung. Dengan begitu, para pemulia menjadi lebih mudah dalam melakukan persilangan. Sebagai contoh pemulia mudah untuk merakit tanaman jagung yang tahan bule (penyakit daun bilur putih). Penelitian ini bekerja sama dengan Balai Penelitian Serealia (Balitisereal), Maros, Sulawesi Selatan.
Metode kultur jaringan juga sudah berkembang di Indonesia. Metode itu banyak digunakan untuk memproduksi tanaman secara massal. Selain itu juga dikembangkan metode penyimpanan plasma nutfah secara ex situ. Plasma nutfah akan disimpan pada suhu minus 180 derajat Celsius dengan menggunakan metode kriopreservasi (menggunakan nitrogen cair).
Teknologi Fusi Protoplast juga sudah cukup berkembang. Dengan teknologi tersebut perkawinan yang terjadi sudah antarprotoplast (antar isi sel). Contohnya, sifat tahan penyakit pada terong liar dipindahkan pada terong budidaya. Saat ini juga sedang dikembangkan padi yang tahan terhadap cekaman biotis (tahan hama penyakit) dan abiotis (tahan kekeringan). (Plantus, 2010)
Selain itu beberapa penelitian biotek tanaman yang sudah membuahkan hasil adalah di antaranya padi tahan penyakit penggerek batang, kedelai tahan penggerek polong, dan jagung tahan penggerek batang. Juga sudah dihasilkan varietas kacang tanah yang tahan terhadap virus dan pepaya yang tahan kemasakan (tidak cepat busuk).
Sedangkan untuk konservasi terdapat laboratorium Bank Genetik yang menyimpan ribuan specimen plasma nutfah. Di antaranya padi (3.500 buah), jagung (875), kedelai (950), kacang tanah (1.200), kacang hijau (1.000), ubi jalar (1.430), dan ubi kayu (560).
Menurut Donald (2009), bioteknologi tanaman Indonesia seperti pertanian dan produksi pangan sudah dirintis secara matang untuk dikembangkan dengan target :
1. Penciptaan tanaman baru yang dapat menghasilkan pupuk sendiri
2. Tanaman yang tahan kekeringan, kebekuan, salinitas tinggi dan tekanan-tekanan lingkungan lainnya
3. Substans yang dapat mempercepat pertumbuhan ternak
4. Vaksin untuk ternak
5. Makanan ternak dengan harga yang lebih murah
Harapan yang ditargetkan tersebut masih belum tercapai secara maksimal. Menurut BPPT, hasil PELITA VI terkait penerapan dan pemanfaatn bioteknologi di Indonesia, secara rata-rata masih jauh tertinggal dari negara maju. Bahkan menurut Swastika (2008), kegiatan bioteknologi modern di bidang pertanian baru sebatas penelitian laboratorium di lembaga-lembaga penelitian dan universitas, sama sekali sangat sedikit yang menyentuh dunia pasar.
Produk bioteknlogi tanaman yang baru menyentuh dunia pasar seperti; biopestisidan, enzim, tanaman herbisida resistan dan beberapa jenis lainnya. Yang belum terlihat sesuai target adalah tanaman tahan kekeringan, kebekuan, dan salinitas toleran.

BAB IV. FAKTOR PENTING YANG MEMPENGARUHI
KEMAJUAN BIOTEKNOLOGI TANAMAN INDONESIA

Perkembangan bioteknologi tanaman di Indonesia diakui oleh para ahli berlangsung secara lamban. Kalaupun ada dilakukan penelitian-penelitian terkait bioteknologi tanaman, itupun baru berlangsung sebatas tingkat penelitian laboratorium di lembaga-lembaga penelitian ataupun universitas.
Ada beberapa faktor penting yang menjadi berpengaruh sehingga menyebabkan bioteknologi tanaman di Indonesia kurang begitu berkembang:
1.Kurang maksimalnya dukungan pemerintah.
Pemerintah sangat berperan penting dalam menyukseskan kemajuan bioteknologi tanaman di Indonesia. Dukungan pemerintah tidak hanya dilakukan sebatas peraturan saja tapi finansial dan peningkatan SDM yang ahli terkait bioteknologi tanaman juga sangat dibutuhkan. Pemerintah China bahkan menginvestasikan anggaran untuk pengembangan biotek tanaman sejak tahun 1990-1999 terus mengalami peningkatan dua ka lipat. Informasi terakhir menyebutkan angka investasi mencapai $ 112.000.000.
Harapan lain bagi peneliti bioteknologi di Indonesia adalah realisasi dari UU No 18/2002 tentang Sistem Nasional Penelitian Pengembangan dan Penerapan Iptek. Dalam UU itu disebutkan bahwa pemerintah pusat, Pemda, dan masyarakat termasuk badan usaha wajib mengalokasikan anggaran untuk penelitian dan pengembangan, baik untuk kepentingan spesifiknya sendiri, maupun kepentingan regional dan nasional. Dengan demikian kendala dana yamg selama ini menghambat kemajuan pengembangan Iptek bisa segera terselesaikan. (Plantus, 2010).
Disisi lain dukungan dari pihak perbankan juga sangat diharuskan. LIPI (2010) menyatakan pengembangan bioteknologi terkendala salah satunya karena kurangnya dukungan pihak perbankan kepada pihak industri yang mengolah produk-produk pertanian.
2. Kurangnya Perlindungan Kekayaan Intelektualitas.
Masih banyaknya produk-produk bioteknologi Indonesia yang tidak dipatenkan telah menyebabkan sebagian produk Indonesia jatuh ke tangan asing. Saat ini banyak paten produk asli Indonesia jatuh di tangan bangsa lain seperti; lebih dari 10 paten mengenai pengolahan rotan terdaftar atas nama USA, paten makanan tradisional tempe dimiliki oleh Jepang, Belanda dan Jerman.
3. Tekanan Global
Isu-isu global yang dihembuskan negara maju seperti isu HAM, demokrasi, lingkungan hidup dapat mengganggu produksi dan perdagangan produk-produk yang berbasis SDA. Juga dalam penerapan standar internasional dan penerapan ISO 14000 tentang manajemen lingkungan hidup, Hazard Analytical Critical Control Point tentang manajemen keamanan pangan dapat merupakan hambatan bagi dunia usaha bioteknologi Indonesia yang belum sepenuhnya siap menghadapi hal tersebut.
4. Pertumbuhan Penduduk Yang Tinggi
Pertumbuhan penduduk Indonesia yang tinggi dapat menjadi beban pemerintah untuk mengembangkan pemenuhan kebutuhan produk-produk pertanian dan kepemilikan lahan.
Faktor-faktor penting tersebut membutuhkan solusi konkret yang paling utama sekali adalah komitmen dari kebijakan pemerintah terhadap pengembangan bioteknologi, khususnya dalam hal pengembangan bioteknologi tanaman.

BAB V. PENUTUP
Perkembangan bioteknologi tanaman di Indonesia masih sangat lambat dibandingkan dengan negara-negara maju di dunia. Indonesia masih berada pada gelombang pertama yaitu produk bioteknologi masih terfokus pada mengatasi permasalahan hama dan penyakit tanaman. Negara-negara maju di dunia seperti Amerika, Eropa dan China sudah berada pada gelombang ketiga dimana fokus produk bioteknologi sudah berorientasi menambah kekayaan nutrisi tanaman.
Ada beberapa faktor penting yang menyebabkan lambatnya kemajuan bioteknologi di Indonesia, termasuk bioteknologi tanaman.
1. Kurangnya dukungan pemerintah
2. Kurangnya perlindungan kekayaan intelektualitas
3. Tekanan Global
4. Pertumbuhan Penduduk yang tinggi.
Faktor-faktor penting tersebut membutuhkan solusi konkret yang paling utama sekali adalah komitmen dari kebijakan pemerintah terhadap pengembangan bioteknologi, khususnya dalam hal pengembangan bioteknologi tanaman.

DAFTAR PUSTAKA
Defri. 2010. Sejarah dan Perkembangan Bioteknologi.http//www.  id.shvoong.com
Diah, Diaz.2007.Sejarah Bioteknologi.http//www. //b3-5tr0ng.blogspot.com
Gale, Fred,dkk.2010.Is Biotechnology in China’s Future ? http://www.reap.ucdavis.edu.
Jelenic. 2005. Food Safety Evaluation Of Crops Produced Through Genetic Engeneering – How To Reduce Unintended Effects ?. http//:www. hrcak.rsce.hr
Junaidi, Wawan. 2010. Resiko dan Dampak Dalam Mengkonsumsi Tanaman Transgenik
LIPI.2010. Peluang dan Tantangan. http//.www.biotek.lipi.go.id
Papatryfon, Illias, dkk. 2007. Analysis report: Consequences,Opportunities, and Challenges of Modern Biotchnology For Europe.http//:www/jrc.ec.europe.eu
Plantus.2010.Bioteknologi Indonesia baru menuju gelombang kedua. http//.www.anekaplanta.wordpress.com
Pokatong, Donald R.2009. Bioteknologi : Ekspetasi, Realita dan Kendala. Http//www.angelfire.com
Priadi, Arif.2009. Biologi.Yudhistira
Reiss, Thomas,dkk. 2004. Performance EU on Member States In Biotechnology. Science and Public Policy Volume 31. Number 5. October 2005. http://www.ingentaconnect.com
Swastika, Dewa KS, dkk.2008.Kebijakan Produksi dan Peredaran Produk Pertanian Hasil Rekayasan Genenik (PRG) Di Indonesia. Journal Analisis Kebijakan Pertanian. Volume 6. No.2. Bogor.
Wikipedia.2010. Bioteknologi. http://id.wikipedia.org
Wikipedia.2010. Pertanian. http://id.wikipedia.org

.

Dipublikasi di Uncategorized | Meninggalkan komentar